Genes	Operon name	Terminator position	Delta G [kcal/mole]	Terminator	Evidence	References	Comments
dnaA,dnaN	dnaAN	3080..3115	-16.0	ACACU<left>GCUGCCGA</left>CCCG<right>UCGGCAGC</right>UUUUCUAUUCGGUAU	Northern blotting (2.9 kb transcript); transcriptional experiments	11395445 (Ogura et al., J. Bacteriol. 183(13):3833-3841, 2001); 2846289 (Moriya et al., EMBO J. 7(9):2911-2917, 1988); 2987847 (Moriya et al., Nucleic Acids Res. 1985, 13(7):2251-2265); BSORF	Readthrough terminator downstream of dnaA, leading to a 1.7 kb transcript. The earlier result (Ogasawara et al., 2987848) showing an internal promoter in front of dnaN is incorrect (Ogura et al., 11395445; Ogasawara, personal communication). The Northern blotting experiments listed in BSORF suggest that readthrough may occur at the terminator downstream of dnaN.
yaaA,recF,yaaB,gyrB	yaaA-recF-yaaB-gyrB	6775..6825	-14.4	AAAAA<left>GCCUUAUUUC</left>CAAUAA<right>GAAAUAAGGC</right>UUUUUUCUGAACAAG	S1 nuclease experiments; transcriptional and expression experiments	2987848 (Ogasawara et al., Nucleic Acids Res. 1985, 13(7):2267-2279); 2987847 (Moriya et al., Nucleic Acids Res. 1985, 13(7):2251-2265)	Internal promoter inside recF. Northern blotting results in BSORF show various transcripts in this region.
gyrA	gyrA	9445..9495	-16.9	AAAAA<left>GCGCAGCUG</left>AAA<right>UAGCUGCGC</right>UUUUUUGUGUCAUAA	S1 nuclease experiments; Northern blotting	2987847 (Moriya et al., Nucleic Acids Res. 1985, 13(7):2251-2265); BSORF	BSORF shows various transcripts in the gyrA region, all terminating at the same position downstream of gyrA.
rrnO-16S,trnO-Ile,trnO-Ala,rrnO-23S,rrnO-5S	rrnO-16S-trnO-Ile-trnO-Ala-rrnO-23S-rrnO-5S	14809..14843	-15.7	UUAAA<left>CCCAGCUC</left>AAU<right>GAGCUGGG</right>UUUUUUGUUUGUUAA	agrees with ribosomal RNA 5' sequence	6312418 (Ogasawara et al., Nucleic Acids Res. 1983, 11(18):6301-6318); 179998 (Sogin & Pace, J. Biol. Chem. 1976, 251(11):3480-3488)
guaB	guaB	17385..17435	-15.7	CAUUU<left>GACAGGGUC</left>UCU<right>GACUCUGUC</right>UAUUUUUUUUAUACUGA	Northern blotting	BSORF
yaaD,yaaE	yaaDE	20796..20845	-27.5	CGCGA<left>GAGCUCUCGUCCCU</left>UUAU<right>GGGGAUGAGGGCUC</right>UUUUUAUUUUCGAUA	Northern blotting	BSORF	BSORF shows both a yaaDE transcript and a longer dacA-yaaDE-serS transcript
dgk,dck	dgk-dck	22467..22510	-14.7	AAAAA<left>GUGAAUCUC</left>AGUC<right>GAGAUUCAC</right>UUUUUCUUUAAAAUA	Northern blotting; downstream genes are on the opposite strand	BSORF
yaaH	yaaH	23847..23897	-11.7	AAAAA<left>GACGUUUC</left>GAUAAUUUG<right>GAAACGUC</right>UUUUUUUCAUGGGGG	Northern blotting (1.5 kb transcript)	10419957 (Kodama et al., J. Bacteriol. 1999, 181(15):4584-4591); BSORF
scr	scr	26696..26735	-12.8	UCAGA<left>CUCACCUA</left>AUAU<right>UAGGUGAG</right>UUUUUUGUUAUGUAA	S1 mapping analysis of the 3' end	2468993 (Struck et al., Mol. Gen. Genet. 1989, 215(3):478-482)	Northern blotting experiments listed in BSORF show various measured mRNA transcripts in the yaaJ-scr region. Struck et al. (1698458) find a promoter in front of yaaJ, upstream of scr, and suggest that transcription starting at this promoter continues into scr. The S1 nuclease mapping of the 3' end shows that transcription ends in the T-stretch of the indicated terminator structure.
bofA	bofA	30069..30107	ND	ND	ND	ND	Northern blotting experiments listed in BSORF show a monocistronic bofA transcript and a longer transcript starting upstream of yaaK, terminating at the same position as the monocistronic transcript.
rrnA-16S,trnA-Ile,trnA-Ala,rrnA-23S,rrnA-5S	rrnA-16S-trnA-Ile-trnA-Ala-rrnA-23S-rrnA-5S	35354..35388	-14.2	UUAAA<left>CCCAGCUU</left>AAU<right>GAGCUGGG</right>UUUUUUGUUUACUCA	proposed	6312418 (Ogasawara et al., Nucleic Acids Res. 1983, 11(18):6301-6318)
csfB	csfB	35720..35745	-9.8	UCAUA<left>GACCU</left>GAAA<right>AGGUC</right>UUUUUUUGUACUCUU	Northern blotting	BSORF
xpaC,yaaN	xpaC-yaaN	ND	ND	ND	Northern blotting	BSORF
abrB	abrB	44793..44855	-12.8	AAAAA<left>CGUUCUUGU</left>UAUGAC<right>ACAAGAACG</right>UUUUUUUAUUGCUUA	Northern blotting (0.4 kb transcript); upstream and downstream genes are on the opposite strand	3145384 (Perego et al., Mol. Microbiol. 2(6) 689-699, 1988); BSORF
metS	metS	47618..47678	-13.4	CAAAA<left>GGUGUUUCACGUGU</left>AACA<right>AUUCGUCGAACACC</right>UUUUGUGUUUCGACA	Northern blotting	BSORF
yabE	yabE	49947..49984	-14.8	GUAUU<left>CAGAGGGU</left>UUUGC<right>GCCCUCUG</right>UUUUUUUCGUUAUAA	Northern blotting	BSORF; SubtiList
rnmV,ksgA	rnmV-ksgA	51492..51531	-10.4	AUAAA<left>GCCCUUU</left>UCUA<right>AAAGGGC</right>UUUUUGUUUUGCGCA	Northern blotting	11233981 (Condon et al., RNA 2001, 7(2):242-253); BSORF
yabG	yabG	52542..52594	-15.1	GAAAA<left>CCUGCAUAG</left>GAGAG<right>CUAUGCGGG</right>UUUUUUAUUUUACAU	Northern blotting (1.0 kb transcript)	10714992 (Takamatsu et al., J. Bacteriol. 2000, 182(7):1883-1888); BSORF
veg	veg	53006..53056	-12.9	AACGG<left>GCAGUGAAC</left>CUUUU<right>GUUUACUGC</right>UUUUUGUUUUGCCCU	Northern blotting (0.3 kb transcript)	12761295 (Fukushima et al., J. Biochem. (Tokyo) 2003, 133(4):475-483); BSORF
sspF	sspF	53370..53410	-16.6	GUGAC<left>CCGGGGGAC</left>GUGCU<right>GUUCCCUGG</right>UUUUUUUAUUUUGGA	Northern blotting (0.3 kb transcript)	6205155 (Stephens et al., J. Mol. Biol. 1984, 176(3):333-348); 6790516 (Ollington & Losick, J. Bacteriol. 1981, 147(2):443-451)
purR,yabJ	purR-yabJ	55657..55713	-15.5	GAAAA<left>GUGAUUCUGG</left>GAGAG<right>CCGGGAUCAC</right>UUUUUUAUUUACCUU	proposed	7638212 (Weng et al., Proc. Natl Acad. Sci. USA 1995, 92(16):7455-7459); SubtiList	Northern blotting results listed in BSORF show a yabH-purR-yabJ, a purR-yabJ, and a yabJ transcript.
spoVG	spoVG	56150..56222	-28.1	AGCAA<left>GGACUGCUGAAAGGGCU</left>GACAUA<right>AGCCUUUUGCCGGCGGUCC</right>UUUUUUAAUUCUGAU	Northern blotting (0.4 kb transcript)	408013 (Segall & Losick, Cell 1977, 11(4):751-761); BSORF
gcaD,prs,ctc	gcaD-prs-ctc	59380..59435	-13.4	CUUAA<left>GGCGUAACC</left>CUCCCGC<right>GGUUACGUC</right>UUUUGUGCUAGAAUG	restriction endonuclease digestion	8522540 (Hilden et al., J. Bacteriol. 177(24): 7280-7284, 1995); 6273816 (Moran et al., Nucleic Acids Res. 9(22);5979-5990, 1981); 2836704 (Truitt et al., Mol. Gen. Genet. 212:166-171, 1988)	The experiments show that gcaD, prs, ctc belong to the same operon, but do not show that genes further downstream do not belong to this operon. Truitt et al. propose that ctc and spoVC are in separate operons. Northern blotting results in BSORF show both a gcaD-prs-ctc transcript and longer transcripts. An internal promoter exists in front of ctc.
spoVT	spoVT	64646..64702	-15.2	GUAAA<left>GAACAGCUCUC</left>CUU<right>GGGACGCUGUUC</right>UUUUUCAUGCGUGCC	insertional mutant	8755877 (Bagyan et al., J. Bacteriol. 1996, 178(15):4500-4507)	An extensive extensive screening for transcripts in the region from rrnO to spo0H by Asai et al. (11283287) revealed no transcripts containing spoVT and the downstream gene yabM. Transcription of the upstream mfd gene was found to continue into spoVT.
yabM,yabN,yabO,yabP,yabQ,divIC,yabR	yabMNOPQ-divIC-yabR	70006..70070	-15.7	AUGAA<left>GCAUCCGUU</left>CAUCCC<right>GACGGAUGC</right>UUUUUUAUUAUCCUC	Northern blotting (5.3 kb transcript)	11283287 (Asai et al., Microbiology 2001, 147(pt.4):919-927); SubtiList	internal promoters in front of yabN (3.7 kb trancript), yabP (1.9 kb transcript), divIC (1.0 kb transcript), and yabR (0.5 kb transcript)
trnSL-Glu1	trnSL-Glu1	70333..70381	-13.9	ACAAA<left>UCGGUUUCU</left>CUUGC<right>AGAAGCCGA</right>UUUUUUUCAUUUUUA	proposed	2832371 (Guzman et al., J. Bacteriol. 1988, 170(4):1598-1609)
spoIIE	spoIIE	ND	ND	ND	ND	ND
ftsH	ftsH	78893..78945	-16.1	AAAAA<left>CUGCCGGC</left>UGAC<right>GCUGGCAG</right>UUUUUUUAUGUAAAU	Northern blotting (2.1 kb transcript)	7608085 (Deuerling et al., J. Bacteriol. 1995, 177(14):4105-4112)	Northern blotting experiments in BSORF also show two longer transcripts, starting from the upstream hprT and yacA genes.
cysK	cysK	82677..82736	-15.6	CAAAA<left>CUCCCGG</left>UUCG<right>CCGGGAG</right>UUUUUUUAUAUUUCG	Northern blotting	BSORF	BSORF shows additional transcripts starting further upstream, but terminating at the same position.
pabB,pabA,pabC,sul,folB,folK,yazB,yacF,lysS	pabBAC-sul-folBK-yazB-yacF-lysS	90213..90273	-25.3	AAAAA<left>GAGCGGUAUCCUCC</left>AUAG<right>GGAAAGGAUGCCGCUC</right>UUUUUAAAUCCCUUA	Northern blotting (7.5 kb transcript)	9084182 (De Sazieu et al., Microbiology 1997, 143(Pt.3):979-989); BSORF	readthrough terminators after pabA (undefined, resulting in a 2.1 kb transcript), after yacF (TTTGCTGCTC<left>ACTGCTAG</left>TTTTACG<right>CTGGCAGT</right>TTTTCTGCTTTTTTCATGAA at 88645..88697, resulting in a 5.9 kb transcript); internal promoter in front of lysS, resulting in a 1.5 kb transcript.
rrnW-16S	rrnW-16S	92131..92183	-17.2	GUUUA<left>GUUUUGAAGGA</left>UCAU<right>UCCUUCGAAAC</right>GUGUUCUUUGAAAACUAG	ND	ND
ctsR,mcsA,mcsB,clpC,radA,yacK	ctsR-mcsAB-clpC-radA-yacK	108555..108605	-4.4	UAAAA<left>CCUUAUGAAUA</left>CGGGUA<right>UAUUAAUGUUGG</right>UUUUUGUUUAUUCUG	Northern blotting (7.0 kb transcript) and S1 nuclease mapping of the 3' end	8793870 (Kruger et al., Mol. Microbiol. 1996, 20(4):713-723)	A ctsR-mcsAB-clpC transcript and various transcripts in the radA-yacKLMN region are listed in BSORF. The 3' nuclease mapping showed two weak termination signals in the AT-rich region at the end of a proposed terminator structure eight base pairs downstream of the stop codon (i.e., in the UUAAAA region in the left arm of the indicated stem-loop). However, mfold cannot detect such a stem-loop structure. Northern blotting results in BSORF show a ctsR-mcsAB-clpC transcript.
yacL,yacM,yacN	yacLMN	ND	ND	ND	proposed	10482513 (Petersohn et al., J. Bacteriol. 1999, 181(18):5718-5724)	Northern blotting results in BSORF show several transcripts in the radA-yacKLMN region, some terminating at yacM and others at yacN.
gltX,cysE,cysS,yazC,yacO,yacP	gltX-cysES-yazC-yacOP	ND	ND	ND	extension analysis; Northern blotting; S1 nuclease mapping	7510287 (Gagnon et al., J. Biol. Chem. 1994, 269(10):7473-7482); 10024179 (Pelchat & Lapointe, RNA 1999, 5(2):281-289); BSORF	terminator sequence GTCTGCTTTTCA<tbox>AACAGAGTGGAACCGCGC</tbox>GGTT<left>AAAGCGTCTCTGTCAT</left>GTTTAC<right>ATGCAGAGACGCTTT</right>TTTTATTGGGTAGAGGAA at 112681..112770 downstream of gltX may represent an antiterminator; the gltX-cysES-yazC-yacOP transcript is rapidly processed to generate a gltX and a cysES-yazC-yacOP mRNA molecule. Northern blotting of gltX shows a 1.7 kb transcript. Gagnon and Pelchat assumes a gltX-cysES transcript, presumably because the yazC ORF was not known at the time. Northern blotting results in BSORF show a gltX, a gltX-cysES-yazC-yacOP, and a cysES-yazC-yacOP transcript.
sigH	sigH	ND	ND	ND	ND	ND
rpoB	rpoB	ND	ND	ND	ND	ND
ybaK,cwlD	ybaK-cwlD	157296..157340	-13.3	GGAGA<left>CCCUCCG</left>GAGUAA<right>UGGAGGG</right>UUUUCUUGUGGUUCU	Northern blotting (1.2 kb transcript)	7559346 (Sekiguchi et al., J. Bacteriol. 1995, 177(19):5582-5589)	Internal promoter in front of cwlD, leading to a 0.73 kb transcript.
gerD	gerD	158475..158529	-17.6	AUAAA<left>GGGAAAGCCGGGAU</left>CUGGA<right>AUCCCGGUUCACC</right>UUUUAUACCUGCACU	upstream and downstream genes are transcribed in the opposite direction	2517635 (Yon et al., J. Gen. Microbiol. 1989, 135(Pt.12):3431-3445)
ybaN	ybaN	159610..159652	-5.0	CAAAU<left>GUUUUC</left>UUA<right>GAGGAC</right>UGCUUUUGCUUUAUAUAA	transcription upstream and downstream of ybaN proceeds in the opposite direction	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)	Dartois (8576055) notes that no transcriptional terminator could be found in the region between kbaA and ybaN.
rrnG-16S	rrnG-16S	92131..92183	-17.2	GUUUA<left>GUUUUGAAGGA</left>UCAU<right>UCCUUCGAAAC</right>GUGUUCUUUGAAAACUAG	ND	ND
feuA,feuB,feuC,ybbA	feuABC-ybbA	179581..179632	-13.1	AAAAA<left>CCGCUCA</left>ACCCUA<right>UGAGCGG</right>UUUUUUUAUGCCUUC	proposed; downstream genes are on the opposite strand	12354229 (Baichoo et al., Mol. Microbiol. 45(6):1613-1629, 2002)
ybbB	ybbB	ND	ND	ND	proposed	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); SubtiList
trnSL-Glu2,trnSL-Val1,trnSL-Thr1,trnSL-Tyr1,trnSL-Gln2	trnSL-Glu2-trnSL-Val1-trnSL-Thr1-trnSL-Tyr1-trnSL-Gln2	194599..194644	-15.0	UCACA<left>GACACCUUU</left>GAUCA<right>AAAGGUGUC</right>UUUUUUCUUUUCGGA	proposed	9683469 (Huang et al., J. Bacteriol. 1998, 180(15):3765-3770)	possibility of readthrough cannot be excluded
sigW,ybbM	sigW-ybbM	196024..196069	-16.2	GAGAA<left>GAGUAAAGCGC</left>GUUA<right>GCCGCUUUGCUC</right>UUUUUUUGCGGGCUG	Northern blotting (1.2 kb transcript)	12207695 (Cao et al., Mol. Microbiol. 2002, 45(5):1267-1276); SubtiList	Synonym: ybbM=rsiW
alkA	alkA	ND	ND	ND	Northern blotting (1.5 kb transcript); upstream and downstream genes are on the opposite strand	8376346 (Morohoshi et al., J. Bacteriol. 175(18), 6010-6017, 1993); BSORF
adaA,adaB	adaAB	205216..205272	-31.7	GUGAA<left>GCCGACAAUUUUCAGGAUUCAAUGAU</left>CUAACAUA<right>AUCAUUGAAAUUUUGAAGUUGUCGGC</right>UUUUUUGUUGGAAAA	Northern blotting (1.6 kb transcript)	2120677 (Morohoshi et al., Nucleic Acids Res. 18(18) 5473-5480, 1990); BSORF	Morohoshi proposes the terminator structure <left>ATAAACTTGACAACTTTT</left><right>AAAATTTAGCATATCTTAT</right> at position 204936..204972; however, it is probably too weak to function as a terminator, and also does not agree with the 1600 bp mRNA found in the Northern blotting experiment (transcription start site is at position 203594).
ybcL	ybcL	213025..213064	-14.3	UCUAA<left>CAUCCGCUCGU</left>UAU<right>ACAAGCGGGUG</right>UUUUUUUUAGCGUAG	Northern blotting (1.2 kb transcript)	BSORF; SubtiList
ybdK	ybdK	ND	ND	ND	ND	ND
ybdO	ybdO	226224..226268	-15.2	UUAGG<left>UAAGCUGUUC</left>AUGUA<right>GGACAGCUUA</right>UUUUUUAUGAGAAUC	Northern blotting (1.2 kb transcript)	15033535 (Serizawa et al., Gene 2004, 329:125-136); BSORF
ybxG	ybxG	227929..227979	-10.6	AAAAA<left>GAGACAUU</left>CACG<right>GAUGUCUC</right>UUUUUUUAUUUUUCG	proposed	9016963 (Shcheptov et al., Gene 1997, 184(1):133-140)	The Northern blotting analysis listed in BSORF shows a 2.0 kb transcript, which corresponds to a ybxG-csgA-ybxH transcript.
csgA,ybxH	csgA-ybxH	228566..228629	-19.2	AUUUA<left>GAGCCCUGC</left>CGU<right>GCAGGGCUC</right>UUUUAUUUAGGAUGU	Northern blotting (0.6 kb transcript)	9016963 (Shcheptov et al., Gene 1997, 184(1):133-140)	terminator is inside the coding region of the downstream gene ybxI, which is transcribed in the opposite direction. Subtilist proposes a different terminator TGAGATTT<left>AGAGCCCTGC</left>CGT<right>GCAGGGCTCT</right>TTTATTTAGGATGTAATC with dG = -18.3 kcal/mole, located immediately downstream of ybxH at position 228501..228549. However, the indicated stem-loop agrees better with the measured mRNA length (transcription start site is near position 228025).
ybxI	ybxI	228500..228546	-5.5	GAUCC<left>UGUUCA</left>UUC<right>UGGGCA</right>UACUUAAUUUCUUUUUCU	Northern blotting (0.8 kb transcript); upstream and downstream genes are on the opposite strand	BSORF
cypC	cypC	230757..230808	-15.6	AAAAA<left>GCUCUCUUC</left>CUUUAUC<right>GAAGAGAGC</right>UUUUUGAUUACUUCU	Northern blotting (1.3 kb transcript); upstream and downstream gene are on the opposite strand	BSORF; SubtiList
ybyB	ybyB	230766..230823	-16.1	AAAAA<left>GCUCUCUUC</left>GAUAAAG<right>GAAGAGAGC</right>UUUUUAAUUUAACUU	Northern blotting (0.3 kb transcript); upstream and downstream gene are on the opposite strand	BSORF
ybeC	ybeC	232940..233002	-15.9	GAAAA<left>CCUUGCGAU</left>AGUU<right>GUCGCAAGG</right>UUUUUUGCUUUUAAU	Northern blotting (1.6 kb transcript); upstream and downstream genes are on the opposite strand	BSORF; SubtiList
glpT,glpQ	glpTQ	232951..233003	-14.1	AAAAA<left>CCUUGCGA</left>CAACUA<right>UCGCAAGG</right>UUUUCUUCUAUAUUU	Northern blotting (2.4 kb transcript)	8012593 (Nilsson et al., Microbiology 1994, 14(Pt.4):723-730); 10913081 (Antelmann et al, J. Bacteriol. 2000, 182(16):4478-4490)	Internal promoter in front of glpQ, leading to a 1.1 kb transcript.
pssA,ybfM,psd	pssA-ybfM-psd	249516..249565	-13.1	AAAAA<left>GAGGAGCUUGC</left>AUAAAC<right>GCAGCGCCUC</right>UUUUUUUGAAGAAAG	Northern blotting (1.9 kb transcript)	14762009 (Cao & Helmann, J. Bacteriol. 2004, 186(4):1136-1146)	Matsumoto et al. (9422599, J. Bacteriol. 1998, 180(1):100-106) propose another terminator located inside ybfM at position 248249..248320: CTGGGAGATGGAATTAGTTCAGCAGCTC<left>ATAGCGGAT</left>TACGGTT<right>ATCTCGCTAT</right>TTTTTTGATGCTGGTATT
ybfO	ybfO	251305..251343	-16.9	CGGUG<left>UCCCCUGU</left>GGUAA<right>ACAGGGGA</right>UUUUUACAUAUCGCA	proposed	SubtiList
ybgB	ybgB	258784..258834	-12.2	UCAAA<left>CAGCCAG</left>AAUAAAA<right>CUGGCUG</right>UUUUCUUUAAUUUCA	ND	ND
ybgE	ybgE	260074..260116	-17.4	AAAAA<left>GAACCUGCC</left>CGGA<right>GGCAGGUUC</right>UUUUUAUUUUGAAUG	Northern blotting (1.2 kb transcript)	15060025 (Mader et al., J. Bacteriol. 2004, 186(8):2240-2252)
ycbC,ycbD,ycbE,ycbF,ycbG,ycbH,ycbJ	ycbCDEFGHJ	277026..277076	-19.5	CGAGA<left>CCCUCGUCCU</left>UUGCAU<right>AGGACGGGGG</right>UUUUUUGUGUUUCUU	Northern blotting (8.3 kb transcript)	12044674 (Hosoya et al., FEMS Microbiol. Lett. 2002, 210(2):193-199); SubtiList	Internal promoter in front of ycbG, leading to a 2.3 kb ybcGH transcript. Measured mRNA transcripts suggest that readthrough terminators may exist behind ycbG and ycbH, leading to a 5.9 kb ybcCDEFG transcript, a 0.8 kb ybcG transcript, a 7.4 ybcCDEFGH transcript, and a 2.3 kb ybcGH transcript. Northern blotting results in BSORF various transcripts in this region.
yczA,ycbK	yczA-ycbK	278289..278329	-2.7	UUACA<left>AUAAGUG</left>UAAU<right>UACGUGUGU</right>GUUUUUUGAUUUUGUA	proposed	10706627 (Sarsero et al., Proc. Natl Acad. Sci. USA 2000, 97(6):2656-2661)	Northern blotting results in BSORF show various transcripts in the yczA-ycbK region. Sarsero et al. suggest that yczA-ycbK may be part of a longer operon, since no clear terminator was found downstream of ycbK.
ycbL	ycbL	ND	ND	ND	ND	ND
cwlJ	cwlJ	282421..282475	-15.1	CAGGA<left>CACCGUUCA</left>AAU<right>UGAACGGUG</right>UUUUUCUUUGAAAAG	Northern blotting (0.47 kb)	9515903 (Ishikawa et al., J. Bacteriol. 1998, 180(6):1375-1380); BSORF
ycbR	ycbR	283267..283324	-17.5	AAGAG<left>CACUGAGUCAUU</left>CUGCGA<right>AAUGGCUCGGUG</right>UUUUUGCUUCUUUUU	Northern blotting (1.2 kb and 1.4 kb transcripts)	BSORF; SubtiList	ycbR is shown as a monocistronic transcript in BSORF, however the indicated transcript lengths are not consistent with the 729 bp length of ycbR.
phoD	phoD	ND	ND	ND	proposed	8760916 (Eder et al., Microbiology 1996, 142(Pt.8):2041-2047)
ycbU	ycbU	288150..288205	-17.7	AAAAA<left>GCCCCUGA</left>ACACUAG<right>UCAGGGGC</right>UUUUCAUAUUAAUGA	Northern blotting (1.1 kb transcript); upstream and downstream genes are on the opposite strand	BSORF; SubtiList
lmrA,lmrB	lmrAB	288158..288216	-16.6	GAAAA<left>GCCCCUGA</left>CUAGUGU<right>UCAGGGGC</right>UUUUUCAUGUUUACU	Northern blotting (2.1 kb transcript)	15317768 (Yoshida et al., J. Bacteriol. 2004, 186(17):5640-5648); 12718394 (Murata et al., Can. J. Microbiol. 2003, 49(2):71-77)	A 0.6 kb lmrA monocistronic transcript due to a readthrough terminator downstream of lmrA was also found.
yccC	yccC	291583..291626	-11.0	GAAAA<left>GAAGGC</left>GAAUAA<right>GCCUUC</right>UUUUUUUUGGCUUUU	proposed; upstream gene is on the opposite strand; the downstream lip gene was shown to be monocistronic in a Northern blotting experiment	11914346 (Fisher & Wray, J. Bacteriol. 2002, 184(8):2148-2154); SubtiList
lip	lip	292397..292444	-15.8	CAAAA<left>CCUUGAAGAAU</left>GCU<right>AUUCUUCAAGG</right>UUAUUCUGCUUUCAG	Northern blotting (1.0 kb transcript); downstream gene is on the opposite strand	BSORF; Genbank M74010
yccG	yccG	294126..294178	-16.9	AAAAA<left>CCUUGAAAAGC</left>CUG<right>GCUUUUCAAGG</right>UUUUUUCCAUUAUGA	Northern blotting (1.0 kb transcript); downstream gene is on the opposite strand	BSORF
yccH	yccH	ND	ND	ND	Northern blotting (0.7 kb transcript)	BSORF
natA,natB	natAB	297869..297920	-9.8	CGAAA<left>GGAGAAA</left>UACAC<right>UUUCUCC</right>UUUUUGUAUAUCCUG	Northern blotting (2.0 kb transcript)	9106203 (Cheng et al., Mol. Microbiol. 1997, 23(6):1107-1120)
yccK	yccK	298937..298994	-8.6	GGAAA<left>UAGCC</left>GUCAU<right>GGCUA</right>UUUCCUUUUGGUGUU	Northern blotting (1.1 kb transcript); downstream gene is on the opposite strand	BSORF; SubtiList
ycdA	ycdA	298946..298999	-8.8	GGAAA<left>UAGCC</left>AUGAC<right>GGCUA</right>UUUCCUUUUUUAUUU	Northern blotting (0.9 kb transcript); upstream and downstream genes are on the opposite strand	BSORF
ycdB	ycdB	301871..301935	-19.4	AAAAG<left>GACCUUUCUUCA</left>CUUUAAA<right>UGAAGAAAGGUC</right>UUUUUAUAUAAUAAA	Northern blotting (1.8 kb transcript); upstream gene is on the opposite strand	BSORF
rapJ	rapJ	305096..305141	-17.4	AAAUG<left>GCAGAGAACU</left>ACA<right>GGUUCUCUGC</right>UUUUUUUGUGCUGUU	Northern blotting (1.0 kb transcript); upstream gene is on the opposite strand	BSORF; SubtiList
ycdH,ycdI,yceA	ycdHI-yceA	310376..310435	-16.4	GAAAA<left>GCAGUUUUCC</left>CUAG<right>GGAAAACUGC</right>UUUUUUUAUAGAAAC	proposed	9811636 (Gaballa & Helmann, J. Bacteriol. 1998, 180(22):5815-5821)	Northern blotting results in BSORF show a ycdHI (1.7 kb) and a yceA (0.9 kb) transcript.
yceC,yceD,yceE,yceF,yceG,yceH	yceCDEFGH	317144..317209	-22.6	UAAAA<left>ACCCCGCUUGUG</left>GAA<right>CAUAAGCGGGGU</right>AUUUCAAUUACAUCAU	proposed	11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457); SubtiList	Northern blotting results in BSORF show various transcripts in this region.
yceK	yceK	ND	ND	ND	Northern blotting (0.3 kb transcript); upstream gene is on the opposite strand	BSORF
opuAA,opuAB,opuAC	opuAABC	323547..323586	-15.4	AAAAA<left>GCAGCCUG</left>UGU<right>CAGGCUGC</right>UUUUUUUGCGUUAAG	Northern blotting (3.0 kb transcript); genes further upstream or downstream are on the opposite strand	7622480 (Kempf & Brenner, J. Biol. Chem. 1995, 270(28):16701-16713); BSORF	Northern blotting results in BSORF also show a shorter transcript at opuAC, but too short to represent a monocistronic transcript of the opuAC gene. Terminator is bidirectional.
amhX	amhX	323552..323597	-15.4	AAAAA<left>GCAGCCUG</left>ACA<right>CAGGCUGC</right>UUUUUUGAUUACUUC	Northern blotting (1.2 kb transcript); upstream and downstream genes are on the opposite strand	8768514 (Kempf & Brenner, FEMS Microbiol. Lett. 1996, 141(2-3):129-137); BSORF	bidirectional terminator.
ycgA	ycgA	326328..326363	-19.6	UUGCU<left>GCCCGCCG</left>GCUUGUA<right>CGGCGGGC</right>UUUUGAGUUAUUCAU	Northern blotting (1.2 kb transcript); upstream gene is on the opposite strand	BSORF; SubtiList
ycgB	ycgB	ND	ND	ND	Northern blotting (0.6 kb transcript)	BSORF
amyE	amyE	329168..329209	-12.9	CGAAA<left>GAAACCAUC</left>AAU<right>GAUGGUUUC</right>UUUUUUGUUCAUAAA	Northern blotting (2.0 kb transcript)	11320136 (Pereira et al., Microbiology 147(5), 1331-1341, 2001); BSORF; SubtiList
ldh,lctP	ldh-lctP	331939..331993	-19.6	AAAAA<left>GCAGUACAUGC</left>CCA<right>GCAUGUACUGC</right>UUUUUUUAUGUUAAU	Northern blotting (2.7 kb transcript)	10809684 (Cruz Ramos et al., J. Bacteriol. 2000, 182(11):3072-3080)	bidirectional terminator. BSORF lists a 2.6 kb and a 1.5 kb transcript, both hybridizing to the lctP probe.
mdr	mdr	331949..332013	-19.6	AAAAA<left>GCAGUACAUGC</left>UGG<right>GCAUGUACUGC</right>UUUUUUCUAUUACAC	Northern blotting (1.6 kb transcript)	9023234 (Ohki & Murata, J. Bacteriol. 1997, 179(4):1423-1427); BSORF; Genbank D50098	bidirectional terminator
ycgF,ycgG	ycgFG	335641..335697	-7.9	CUGGC<left>AGGGCG</left>AUCUUUG<right>UGACCCU</right>ACUUUUUUUGAUAGAUC	downstream gene ycgH is in the opposite direction; no experimental evidence that ycgF and ycgG are in the same operon	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)	Northern blotting results in BSORF show a ycgEFG and a ycgG transcript.
ycgI	ycgI	ND	ND	ND	Northern blotting (0.7 kb transcript)	BSORF
nadE	nadE	338659..338704	-17.4	AGAAA<left>GCCCGCUC</left>UCG<right>GAGCGGGC</right>UUUUGUCGUGUACAG	proposed; downstream gene is on the opposite strand	2435704 (Albertini et al., J. Bacteriol. 1987, 169(4):1480-1484)
tmrB	tmrB	338661..338708	-17.4	CAAAA<left>GCCCGCUC</left>CGA<right>GAGCGGGC</right>UUUCUUCAACUUAUU	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF
aroK	aroK	340126..340184	-16.2	AAAAA<left>GCCGUGCG</left>CAG<right>CGCACGGC</right>UUUUUUUAUCGUUUU	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF
cah	cah	343043..343097	-9.9	AAAAG<left>CCGCC</left>GCAUAUCAUCA<right>GGCGG</right>UUUUUUUCUGCAAAC	Northern blotting (1.0 kb transcript)	7793942 (Mitsushima et al., Appl. Environ. Microbiol. 1995, 61(6):2224-2229); BSORF
ycgT	ycgT	353578..353626	-6.0	AAGGG<left>CUGCUUGCC</left>AUCA<right>GGUGUGAAG</right>GAGUUUUUUCUCUGCAUG	Northern blotting (1.4 kb transcript)	BSORF
nasB,nasC,nasD,nasE,nasF	nasBCDEF	353424..353463	-13.7	GCAAG<left>CAGCCCUU</left>UUCCUC<right>AAGGGCUG</right>UUUUAUUUAUGCACC	Northern blotting (9.2 kb transcript)	7836289 (Nakano et al., J. Bacteriol. 1995, 177(3):573-579); 9765565 (Nakano et al., J. Bacteriol. 1998, 180(20):5344-5350); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)	internal promoter in front of nasD, leading to a 4.5 kb transcript
nasA	nasA	ND	ND	ND	Northern blotting (1.3 kb transcript)	7836289 (Nakano et al., J. Bacteriol. 1995, 177(3):573-579); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); 7868621 (Ogawa et al., J. Bacteriol. 1995, 177(5):1409-1413)	Ogawa proposes a putative terminator 150 bp downstream of nasA (sequence unknown); this doesn't agree well with the measured mRNA length (transcription start site is at position 362454).
yciA,yciB,yciC	yciABC	366801..366849	-13.5	AAAAA<left>GCCGUCCC</left>AUG<right>GGGAACGGC</right>UUUUUUUAAUGAAAC	downstream genes are on the opposite strand	9811636 (Gaballa & Helmann, J. Bacteriol. 1998, 180(22):5815-5821)	Internal promoter in front of yciC.
yckC	yckC	369212..369273	-13.5	AGAAA<left>GAGCGAAU</left>AAUG<right>GUUCGCUC</right>UUUUUAUUUUUAUGC	Northern blotting (0.5 kb transcript)	BSORF
yckE	yckE	371239..371289	-18.3	AAGAG<left>UCCCUGAGAG</left>UUAUU<right>CUCUCAGGGG</right>UUUUUCAUUACACAG	Northern blotting (1.5 kb transcript)	BSORF; SubtiList	bidirectional terminator. The Northern blotting experiments listed in BSORF also show a longer 2.4 kb transcript.
nucA,nin	nucA-nin	371227..371293	-18.4	AAAAC<left>CCCUGAGAG</left>AAUAA<right>CUCUCAGGG</right>ACUCUUUAUAAACUUUC	proposed	7746143 (Van Sinderen et al., Mol. Microbiol. 1995, 15(2):213-223); 2841296 (Vosman et al., J. Bacteriol. 1988, 170(8):3703-3710)	Bidirectional terminator. BSORF also shows monocistronic nucA and nin transcripts. Another terminator-like structure GUCAAUUGUCCAA<left>UCCCAGUUGC</left>UCGUU<right>GUCAGAUGCGGA</right>UUUUUUUUCGUUUUG (dG = -7.3 kcal/mole) was found at position 370828..370882 inside the coding region of the downstream gene yckE.
tlpC	tlpC	ND	ND	ND	proposed	7746143 (Van Sinderen et al., Mol. Microbiol. 1995, 15(2):213-223); 7921238 (Hanlon et al., Microbiology 1994, 140(Pt.8): 1847-1854)	Hanlon was not able to locate an obvious transcriptional terminator after tlpC, but notes that tlpC is probably monocistronic as the downstream gene nucA is specific for competence. Can Sinderen et al. suggest the terminator TGATTA<left>ATCAAGCCG</left>AAAA<right>CGGCTGAT</right>GACTTACTATCATTATTG (dG = -9.0 kcal/mole) at position 372311..372355. BSORF does not contain a Northern blotting result for tlpC. The nucA-nin transcripts listed in BSORF start downstream of tlpC.
hxlA,hxlB	hxlAB	374120..374166	-19.3	CACAA<left>CCGGCCUGA</left>AGA<right>UCAGGCCGG</right>UUUUAUUUUUUCUAA	Northern blotting (1.3 kb transcript found with hxlB probe; 1.5 kb transcript found with hxlA probe)	10572115 (Yasueda et al., J. Bacteriol. 1999, 181(23):7154-7160); 7921238 (Hanlon et al., Microbiology 1994, 140(Pt.8): 1847-1854); BSORF	synonym: yckFG
hxlR	hxlR	375937..375979	-12.0	UGUAA<left>GACGCUCUU</left>CGC<right>AAGGGUGUC</right>UUUUUUUGCCUUUUU	Northern blotting (0.3 kb transcript)	BSORF; SubtiList
srfAA,srfAB,comS,srfAC,srfAD	srfAA-srfAB-comS-srfAC-srfAD	402679..402726	-17.9	CAAAA<left>GCGGACAGC</left>UUCG<right>GCUGUUCCGC</right>UUUUUUUGUGUUGAA	lacZ insertions	8355609 (Cosmina et al., Mol. Microbiol. 1993, 8(5):821-831); 1715856 (Nakano et al., J. Bacteriol. 1991, 173(5):1770-1778)	The lacZ insertions show that the length of the operon is at least 25 kb, which covers srfAA-srfAB-comS-srfAC.
ycxA	ycxA	403996..404051	-16.0	UAAAA<left>GGAUCAGCA</left>CUGUCAA<right>UGCUGAUCC</right>UUUUUAAAUUUGAGU	Northern blotting (1.3 kb transcript)	BSORF; SubtiList
ycxC,ycxB	ycxCB	404009..404067	-18.1	AAAAA<left>GGAUCAGCAU</left>UGACA<right>GUGCUGAUCC</right>UUUUAUAUUGAAUGG	Northern blotting (1.6 kb transcript)	BSORF	Northern blotting results in BSORF suggests the existence of an internal promoter in front of ycxB, leading to a 0.6 kb transcript.
yczE	yczE	407784..407831	-11.9	UAAAA<left>CAAAGCC</left>GCCUU<right>GGCUUUG</right>UUUUUUUAUUUUCUC	Northern blotting (0.65 kb transcript)	BSORF
yckK,yckJ,yckI	yckKJI	408695..408751	-16.4	CAAAA<left>UCCUAAAACGA</left>UAU<right>UCGUUUUAGGA</right>UUUUGUGAUUUUCAG	Northern blotting (2.3 kb transcript)	15262924 (Burguiere et al., J. Bacteriol. 2004, 186(15):4875-4884); BSORF	SubtiList suggests the terminator GTTTGCCAAC<left>ACGCTGAAACAGGGCG</left>CCTG<right>CGCGCCTGTTTTTTTGT</right>TGAGCCCCTTTCGCCTATT (dG = -16.8 kcal/mole) at position 408524..408589, 198 basepairs downstream of the stop codon. However, the indicated terminator (found by mfold; located 34 basepairs downstream of the stop codon) agrees better with the Northern blotting experiment listed in BSORF, which showed a 2.3 kb transcript.
yclE	yclE	415760..415804	-20.1	AAAAA<left>CAGCCCGCAGAU</left>CAAC<right>AUCCGCGGGCUG</right>UUUCUGAUUAUAAGA	Northern blotting (0.8 kb transcript)	BSORF
yclF	yclF	415760..415811	-25.2	AGAAA<left>CAGCCCGCGGAU</left>GUUG<right>AUCUGCGGGCUG</right>UUUUUUAUUGAUCAA	upstream and downstream genes are on the opposite strand	SubtiList
rapC,phrC	rapC-phrC	429635..429693	-18.1	ACAAG<left>CCCCUUCUC</left>AUUAGC<right>GAGAAGGGG</right>UUUUUCUUUUCAAAA	transcriptional fusions; downstream gene is in the opposite direction	1702397 (Carter et al., Gene 1990, 96:101-105); 10464187 (Lazazzera et al., J. Bacteriol. 1999, 181(17):5193-5200)	internal promoter in front of phrC. Northern blotting results in BSORF show various transcripts in this region.
yclM	yclM	430144..430187	-19.1	AUAAA<left>UAGCGGGCG</left>GCAG<right>CGCCCGCUA</right>UUUUUUUAUAUCACC	Northern blotting (1.5 kb transcript); upstream and downstream genes are on the opposite strand	BSORF; SubtiList
yclN,yclO,yclP,yclQ	yclNOPQ	435546..435601	-19.1	AAAAA<left>GAGCCUCCGCU</left>AAAU<right>AGCGGGGCUC</right>UUUUUUUGUUAAUCA	proposed	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); SubtiList	Northern blotting results in BSORF show a yclNOPQ (3.6 kb), a yclOPQ (2.6 kb), a yclPQ (1.7 kb), and a yclQ (1.0 kb) transcript.
ycnC,ycnB	ycnCB	435558..435613	-21.2	AAAAA<left>GAGCCCCGCU</left>AUUU<right>AGCGGAGGCUC</right>UUUUUGGUUUUACUU	Northern blotting (2.4 kb)	BSORF
ycnE,ycnD	ycnED	438041..438086	-22.9	UAUUC<left>GGCCUGUCGGA</left>UUU<right>UCCGGCAGGCC</right>UUUCAUUUACCCGGU	Northern blotting (1.1 kb transcript)	BSORF
yczG	yczG	439580..439623	-10.0	AUCAA<left>UCCCC</left>UGUAAC<right>GGGGA</right>UUUUUUUAUGUCCGU	Northern blotting	BSORF
gabR	gabR	439384..439430	-11.9	AUUUG<left>GCAACCUGCA</left>CAUC<right>UGCACAGGUGCUGC</right>ACGUUUUUUCUUUUGCUU	ND	ND
gabT,gabD	gabTD	443918..443958	-24.2	CCUGA<left>GAGCUGCCGGA</left>UUU<right>UCCGGCAGCUC</right>UUUUUGUGUUCCGGC	lacZ gene fusion to gabT and gabTD; 5' primer extension analysis of the downstream glcU-gdh operon; Northern blotting (2.6 kb transcript)	12123465 (Belitsky et al., Mol. Microbiol. 2002, 45(2):569-583); BSORF	The lacZ fusions showed that an internal promoter (sigma factor unknown) exists between gabT and gabD). The Northern blotting results in BSORF only showed the gabTD transcript.
glcU,gdh	glcU-gdh	445694..445743	-14.3	AAAAA<left>GCGACCCAGA</left>CAUGACA<right>UCUGGAUCGC</right>UUUCUUUAUUAGGCA	5' primer extension analysis of gdh; genes downstream of gdh are on the opposite strand; Northern blotting (1.6 kb transcript)	3141376 (Rather & Moran, J. Bacteriol. 1988, 170(11):5086-5092); 3082854 (Lampel et al., J. Bacteriol. 1986, 166(1):238-243); 2493633 (Nakatani et al., Nucleic Acids Res. 1989, 17(3):999-1017); BSORF	Northern blotting experiment described by B. Uratani, K.A. Lampel, R.H. Lipsky, E. Freese, in "Molecular Biology of Microbial Differentiation", edited by J.A. Hoch & P. Setlow, American Society for Microbiology, Washington DC, pp. 71-76 (1985). BSORF also shows a glcU-gdh Northern blotting result.
ycnL	ycnL	449092..449140	-16.2	GAAAA<left>GGCUCCUG</left>AAAC<right>CAGGAGCC</right>UUUUUAUUUUUAAAA	Northern blotting (0.35 kb transcript)	BSORF
mtlA,mtlD	mtlAD	452289..452330	-17.7	GACCA<left>CCCGUGACA</left>CAA<right>UGUCACGGG</right>CUUUUUUUACUAUCUC	Northern blotting (3.0 kb transcript)	12897001 (Watanabe et al., J. Bacteriol. 2003, 185(16):4816-4824); BSORF; SubtiList
ycsA	ycsA	ND	-26.3	UCUGA<left>UGAAUCAGGCCGGUGGCAG</left>AUGG<right>CUGCCCCGGUCUGUCCA</right>UUUCCUUACGAAAAU	Northern blotting (0.9 kb transcript)	BSORF
sipU	sipU	454206..454263	-14.2	UGAAA<left>CGGUGCGGAG</left>CCGGCU<right>UUCCGCCCCG</right>UUUUUUAUGAUAGAA	Northern blotting (0.6 kb transcript); downstream gene is on the opposite strand	BSORF; SubtiList
yczH	yczH	ND	ND	ND	Northern blotting (0.4 kb and 0.6 kb transcripts)	BSORF
ycsD	ycsD	455293..455331	-19.9	AAAAA<left>AACCCUUCACAA</left>CAUU<right>UUGUGAGGGGUU</right>CUAUUUUGUGUCGUAAUC	Northern blotting (0.5 kb transcript)	BSORF
ycsE	ycsE	456361..456407	-14.9	AAAAA<left>GAGAGUCC</left>UAAGAU<right>GGACUCUC</right>UUUUUAGUUUGGCAG	Northern blotting (0.8 kb transcript)	BSORF; SubtiList
ycsF,ycsG,ycsI,kipI,kipA,kipR,ycsK	ycsFGI-kipIAR-ycsK	462613..462663	-14.1	GAAAA<left>CGCGCCU</left>CAUGAC<right>AGGCGCG</right>UUUUUUAUGUGUGAU	proposed	9334321 (Wang et al., Genes Dev. 1997, 11(19):2569-2579); SubtiList	Northern blotting results in BSORF show a monocistronic ycsF transcript (0.65 kb), a ycsGI-kipIAR transcript (4.5 kb), and a monocistronic ycsK transcript (0.65 kb).
yczI	yczI	ND	ND	ND	Northern blotting (0.25 kb transcript)	BSORF
yczJ	yczJ	462625..462682	-10.4	CAAAA<left>ACGGCGGU</left>AUAAAUAUUAAAAGC<right>GCCUGAGCCGU</right>CAUUUUCUUUUUUGCGC	Northern blotting (0.3 kb transcript)	BSORF
mtlR	mtlR	468769..468812	-15.2	CAUGG<left>CACACGUCAA</left>AAAU<right>UUGGCGUGUG</right>UUUUUCUGUGGAUGG	Northern blotting (2.1 kb transcript)	12897001 (Watanabe et al., J. Bacteriol. 2003, 185(16):4816-4824)	Northern blotting results in BSORF show a ycsN and a ycsN-mtlR transcript.
ydaD,ydaE,ydaF,ydaG	ydaDEFG	474152..474209	-15.3	ACAAA<left>CCGCCCGGC</left>GUAC<right>GCCGGACGG</right>UUUUUUUAUUGCAAA	Northern blotting (2.8 kb and 3.3 kb transcripts)	10220166 (Petersohn et al., Microbiology 1999, 145(Pt.4):869-880)	A readthrough terminator TTTACCGATCCAAGA<left>ATATAAGGATGGCT</left>TAAC<right>AGCCCATCCTTTTTGT</right>ATTGAAAAAA with dG = -11.6 kcal/mole at position 472626..472684 downstream of ydaE leads to a 1.6 kb transcript. Both ydaDEFG transcripts terminate before reaching ydaH. An internal promoter in front of ydaG leads to monocistronic ydaG transcripts of 0.47 kb, 0.6 kb, and 0.9 kb. A 1.6 kb ydaFG transcript was also detected.
lrpC	lrpC	ND	ND	ND	proposed	9341680 (Beloin et al., Mol. Gen. Genet. 1997, 256(1):63-71)	Genbank AB001488 lists no terminator for lrpC. The terminator ACGG<left>GCGCGGU</left>UAGAGAGU<right>GCCGCGC</right>GAAGUCUGUUAU (dG = -16.0 kcal/mole) at 476037..476074, suggested by Beloin, lacks a T-stretch.
ydaP	ydaP	490097..490149	-14.4	AAAAA<left>ACAGGGGC</left>CCUAAGA<right>GCCCUUGU</right>UUUUUUUUUUUUUUU	Northern blotting (1.8 kb transcript)	10220166 (Petersohn et al., Microbiology 1999, 145(Pt.4):869-880)
ydaT,ydaS	ydaTS	492158..492205	-17.7	CAGGA<left>GGCAUCGUUUC</left>GAAAU<right>GAAACGAUGUC</right>UUUUUAUAUGGGACC	proposed	10482513 (Petersohn et al., J. Bacteriol. 1999, 181(18):5718-5724)
ydbA	ydbA	493919..493971	-11.5	AGAAA<left>GCAGACGGA</left>CACCGCGA<right>UCCGCCUGC</right>UUUUUUUAGUGGAAA	primer extension of downstream gsiB gene	1378051 (Mueller et al., J. Bacteriol. 1992, 174(13):4361-4373)
gsiB	gsiB	494452..494503	-20.7	AAAAA<left>GCGAUCCGGC</left>ACAUCA<right>GCUGGAUCGC</right>UUUUUUUUGGAAUCU	hybrid formation with RNA probes	1378051 (Mueller et al., J. Bacteriol. 1992, 174(13):4361-4373)
dctB,ydbD	dctB-ydbD	495257..495297	-16.7	GACAA<left>GCCCAAAACA</left>UGA<right>UGUUUUGGGC</right>UUUGAUUAUGCCUUC	Northern blotting (2.0 kb transcript)	10708364 (Asai et al., Microbiology 2000, 146(Pt.2):263-271); Genbank AB001488
dctS,dctR,dctP	dctSRP	500983..501029	-14.7	AAGAA<left>CGGCCCA</left>UCCA<right>UGGGCCG</right>UUUUUUUAAUUGUUU	Northern blotting (3.8 kb transcript)	10708364 (Asai et al., Microbiology 2000, 146(Pt.2):263-271); Genbank AB001488	internal promoter in front of dctP, leading to a 1.3 kb transcript
ydbN	ydbN	505858..505903	-10.1	AAAAA<left>GAGCC</left>GGUAA<right>GGCUC</right>UUUUUUUUAUGACUC	upstream and downstream gene are on the opposite strand	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); Genbank AB001488
ydbO	ydbO	507323..507389	-20.1	AAAUU<left>CAGUCACUUCUUCAGGCGUU</left>UUGGCAUU<right>GGCGCUGUGAAGGUGAGCUG</right>UUUUUUCACCGUUCU	upstream and downstream genes are on the opposite strand	ND
ydbP	ydbP	507234..507286	-16.5	AUGAA<left>CAUGAACAUGA</left>GUGACA<right>UCGUGUUCAUG</right>UUUUAUUUUGUCUUC	ND	ND
ydbS,ydbT	ydbST	514558..514598	-19.1	UCUGA<left>AGCGGCGGU</left>UAAU<right>ACCGCCGCU</right>CUUUUUUUUGCACGCA	downstream gene is on the opposite strand	11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457); SubtiList	no experimental evidence that ydbS and ydbT belong to the same operon; Genbank AB001488 does not list a terminator after ydbT
ydcA	ydcA	3106076..3106128	-13.8	CAAAA<left>UCCUAAAAUGG</left>UUU<right>UCAUUUUAGGA</right>UUUUGUCAUCUUUUC	upstream and downstream genes are transcribed in the opposite direction	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)	No terminator listed in Genbank AB001488
ydcC	ydcC	516813..516856	-11.5	CCAAA<left>GGCCAAA</left>CAUGA<right>UUUGGCC</right>UUUUUUUCGUUAGAC	proposed	Genbank AB001488
ydcE	ydcE	518856..518897	-11.8	UGCAG<left>GUUGCUC</left>AAAUA<right>GAGCAAC</right>UUUUUUUGUUUUCAA	proposed	8002610 (Wise & Price, J. Bacteriol. 1995, 177(1):123-133)
rsbR,rsbS,rsbT,rsbU,rsbV,rsbW,sigB,rsbX	rsbRSTUVW-sigB-rsbX	523799..523851	-13.5	AAAAA<left>GAAGCUGG</left>ACAU<right>CCGGCUUC</right>UUUUUUUUGCGGUUG	S1 nuclease mapping of 3' end; lacZ fusion to rsbV; the promoter in front of rsbR was the only promoter detected in the rsbRSTU region	2170324 (Kalman et al., J. Bacteriol. 1990, 172(10):5575-5585); 8002610 (Wise & Price, J. Bacteriol. 1995, 177(1):123-133)	The S1 nuclease mapping showed that transcription ends in the T-stretch of the indicated terminator (positions 523844..523849). Internal promoter in front of rsbV.
phrI	phrI	548129..548179	-13.1	AAAAA<left>GCUUAAUCUUU</left>UUUC<right>GAAGGUUAAGC</right>UUUUUCUUUUAUUUA	proposed	11466295 (McQuade et al., J. Bacteriol. 2001, 183(16):4905-4909); Genbank AB001488
nap	nap	591748..591791	-12.9	AAAAA<left>UAGAGUCC</left>CUCUUAU<right>GGACUCUA</right>UUUUUCUUGGACAAA	Northern blotting (0.9 kb transcript); downstream genes are on the opposite strand	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
ydfK	ydfK	592901..592941	-7.1	AGCGG<left>CUCC</left>ACAAA<right>GGAG</right>GUUAAUAUUCUGUUAU	ND	ND
ydfO	ydfO	ND	ND	ND	ND	ND
dinB	dinB	607759..607802	-17.8	AAAAA<left>GCGGCUCC</left>CUAAAU<right>GGAGCCGC</right>UUUUUUCGGGAAAUA	proposed	1847907 (Cheo et al., J. Bacteriol. 1991, 173(5):1696-1703); SubtiList
ydhD	ydhD	ND	ND	ND	Northern blotting (1.3 kb transcript)	11011148 (Kodama et al., J. Biochem. (Tokyo) 2000, 128(4):655-663)
phoB,ydhF	phoB-ydhF	618823..618874	-22.2	AUCAA<left>GAACUCCCGUAC</left>AAG<right>GUACGGGAGUUC</right>UUUUUCUUAUUUGUU	Northern blotting (2.2 kb transcript)	 10913081 (Antelmann et al, J. Bacteriol. 2000, 182(16):4478-4490)
ydhK	ydhK	624642..624690	-13.2	AAAAA<left>UCCUCCUU</left>UUAC<right>AAGGAGGA</right>UUUUUUUGCUGUUUG	ND	ND
ydhU	ydhU	633424..633474	-20.9	GGGAA<left>GGUGCUCAAGA</left>AACU<right>UCUUGAGCACC</right>UUCUUAAUUGUGACA	upstream and downstream coding regions are on the opposite strand	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); Genbank AB001488
groES,groEL	groESL	651651..651699	-20.0	GAGAA<left>GGUCUUUCAUCAGUUU</left>ACU<right>AAACUGUUGGGAGACC</right>UUUUCUCCAUAUUAG	Northern blotting (2.1 kb transcript)	1350776 (Li & Wong, J. Bacteriol. 1992, 174(12):3981-3992)	Oshima (11751814) finds a 7.6 kb groESL-ydiNOP readthrough transcript induced by heat treatment.
ydiO,ydiP	ydiOP	657268..657342	-18.2	AGUAU<left>CGGAGCUGG</left>AUAAAA<right>CCAGCUCCG</right>UUUUUUAUCUUUAAU	Northern blotting (3.0 kb transcript)	11751814 (Ohshima et al., J. Bacteriol. 2002, 184(2):381-389); Genbank AB007637	The measured length of the mRNA transcript suggests that the upstream ydiN gene also belongs to this operon. No hybridization with a ydiN probe was attempted. Another potential terminator AACAUUU<left>GACUGUGGAAGGCCCAUGAG</left>UUC<right>CUCAGGGCCUUCCACAGUC</right>UCUCGAUU (dG = -38.9 kcal/mole) was found at position 657495..657551 further downstream.
ydiR,ydiS,ydjA	ydiRS-ydjA	ND	ND	ND	Northern blotting (4.0 kb transcript)	11751814 (Ohshima et al., J. Bacteriol. 2002, 184(2):381-389)
ydjC	ydjC	664232..664277	-16.4	CGAAA<left>GGCCAACUG</left>CGACUU<right>CAGUUGGCC</right>UUUCCUAUUUAUAAU	proposed; downstream gene is on the opposite strand	Genbank AB007637	bidirectional terminator
gutR	gutR	664237..664286	-18.0	GGAAA<left>GGCCAACUG</left>AAGUCG<right>CAGUUGGCC</right>UUUCGUUUCUUAUUA	Northern blotting (2.8 kb transcript); upstream and downstream genes are on the opposite strand	12897001 (Watanabe et al., J. Bacteriol. 2003, 185(16):4816-4824); Genbank AB007637	bidirectional terminator
gutB,gutP	gutBP	ND	ND	ND	Northern blotting (2.5 kb transcript)	12897001 (Watanabe et al., J. Bacteriol. 2003, 185(16):4816-4824)
pspA,ydjG,ydjH,ydjI	pspA-ydjGHI	674329..674385	-15.0	GAAAA<left>GUCCGGAGUG</left>AUCAG<right>CACUCGGGAC</right>UUUUUUAUUUAGGAG	Northern blotting (3.6 kb transcript)	15033535 (Serizawa et al., Gene 2004, 329:125-136); 11454200 (Wiegert et al., Mol. Microbiol. 2001, 41(1):59-71); 9455482 (Kasahara et al., DNA Res. 1997, 4(5):335-339)	Bidirectional terminator. A readthrough terminator TACATAGGAG<left>GCCGCAGC</left>TTTCG<right>GCTGCGGC</right>GTCATTTTATCATAAAATGTGAGAGGG was found downstream of pspA at 671646..671703, leading to a 0.7 kb transcript.
ydjJ	ydjJ	674321..674400	-13.5	AAAAA<left>GUCCCGAGUG</left>CUGAU<right>CACUCCGGAC</right>UUUUCACUGUAUGAU	proposed; upstream and downstream gene are on the opposite strand	Genbank AB007638	bidirectional terminator
ydjK	ydjK	677403..677453	-13.4	AAGAA<left>UCCGCAC</left>CCGA<right>GUGCGGA</right>UUCUUUUUGGUUUCA	Northern blotting (1.7 kb transcript)	11807058 (Yoshida et al., J. Bacteriol. 2002, 184(4):983-991); Genbank AB007638	Bidirectional terminator. ydjK synonym is iolT
ydjL	ydjL	677415..677470	-18.7	AAAAA<left>GAAUCCGCAC</left>UCGG<right>GUGCGGAUUC</right>UUUUUUAAAUUAUCC	proposed; upstream and downstream gene are on the opposite strand	Genbank AB007638	bidirectional terminator
ydjM	ydjM	679311..679359	-10.2	GGAAA<left>GCAAGAA</left>GUCACA<right>UUCUUGC</right>UUUUUCUAUUGGUGG	proposed	Genbank AB007638
yeaA,ydjP,ydjO	yeaA-ydjP-ydjO	ND	ND	ND	proposed; downstream gene is on the opposite strand	9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371)
cotA	cotA	682972..683024	-11.3	ACAAA<left>CUUGCCU</left>CUAGC<right>AGGCAAG</right>UUUUUUCUUUAUGAA	proposed	Genbank AB007638
gabP	gabP	684656..684708	-15.7	UCAAA<left>UCCUAAACGG</left>CCUG<right>CCGUUUAGGA</right>UUUUGUUAUUUUCUU	proposed	8951816 (Ferson et al., Mol. Microbiol. 1996, 22(4):693-701); Genbank U51115
guaA	guaA	693630..693688	-24.1	GGAAA<left>CCAUCUUUUUGGCA</left>AUUU<right>UGCCGGGAAGAUGG</right>UUUUAUUUGUUUAUU	proposed	1312531 (Mantsala & Zalkin, J. Bacteriol. 1992, 174(6):1883-1890)
pbuG	pbuG	695325..695376	-17.3	AAAAA<left>CCAGCUGC</left>ACUG<right>GCAGCUGG</right>UUUUUUUUGUUGCAA	proposed	12923093 (Johansen et al., J. Bacteriol. 2003, 185(17):5200-5209); Genbank U51115
purE,purK,purB,purC,purS,purQ,purL,purF,purM,purN,purH,purD	purEKBCSQLFMNHD	710747..710792	-15.1	GAAAA<left>CCCGCAG</left>AAUAG<right>CUGCGGG</right>UUUUUUGUUAUCAAA	S1 nuclease mapping of 3' end (transcript ends at the T at position 710789); Northern blotting (12.8 kb transcript)	3036807 (Ebbole & Zalkin, J. Biol. Chem. 1987, 262(17):8274-8287); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
sapB	sapB	725339..725386	-19.3	UAAAA<left>GCCAAUGGGA</left>CUGGAA<right>UCCCAUUGGC</right>UUUUUCUAUCUACAC	proposed	9043134 (Whalen & Piggot, Microbiology 1997, 143(Pt.2):577-583)
opuE	opuE	726142..726188	-17.2	AAUAA<left>GCCAUCAAGC</left>GCA<right>GCUUGGUGGC</right>UUUUGUGCUCUUGUU	Northern blotting (1.6 kb transcript)	9701821 (Spiegelhalter & Bremer, Mol. Microbiol. 1998, 29(1):285-296); 11902719 (Von Blohn et al., Mol. Microbiol. 1997, 25(1):175-187); 9043134 (Whalen & Piggot, Microbiology 1997, 143(Pt.2):577-583)	readthrough into downstream sapB, leading to a 2.4 kb transcript.
rapH	rapH	751556..751604	-8.8	AGAAA<left>GCCCU</left>UAGCU<right>AGGGC</right>UUUUUCUUGCUUUAC	proposed	SubtiList
yesE,yesF	yesEF	755113..755155	-16.3	AGAAA<left>GACCUUCGG</left>CGCUU<right>CCGAAGGUC</right>UUCUUAUUGAAAAAG	proposed	7768848 (Henriques et al., J. Bacteriol. 1995, 177(12):3394-3406)
cotJA,cotJB,cotJC,yesJ,yesK	cotJABC-yesJK	ND	ND	ND	Northern blotting (1.9 kb transcript)	7768848 (Henriques et al., J. Bacteriol. 1995, 177(12):3394-3406); 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)	Northern blotting experiment by Yoshida. Eichenberger proposes a cotJABC-yesJ transcript, Henriques a cotJABC transcript.
yfnI	yfnI	797564..797621	-30.0	AAAAA<left>GAGCCUUGAGCGGGC</left>GCAUU<right>GCCUUCGCUCAAGGCUC</right>UUUUUUUGGUUAUAC	Northern blotting	BSORF; Genbank D86418
yfnH,yfnG,yfnF,yfnE,yfnD	yfnHGFED	802612..802654	-18.6	AAAAC<left>CCCCUGCC</left>GCCU<right>GGCAGGGG</right>UUUUUUCAGCUAUGC	Northern blotting	BSORF; Genbank D86418	bidirectional terminator
yfnC	yfnC	802619..802662	-20.6	AAAAA<left>CCCCUGCC</left>AGGC<right>GGCAGGGG</right>GUUUUUUAAUCCAGCU	Northern blotting	BSORF; Genbank D86418	bidirectional terminator
yfnB	yfnB	803973..804020	-22.2	GAAAA<left>UACCGUCAGCU</left>GCUAAUCA<right>GGCUGACGGUA</right>UUUCUUUCAUAAGAA	Northern blotting	BSORF; Genbank D86418
yfnA	yfnA	804746..804804	-19.0	UUUCA<left>GCCGGCGGUG</left>CCU<right>CACCCGCCGGC</right>UUUUUCCUUUUUUUA	Northern blotting	BSORF
yfmT,yfmS	yfmTS	808736..808795	-19.6	UAAGA<left>GACCGGGGA</left>CAAACA<right>UCCCCGGUC</right>UUUUUCUUAUCCUGC	Northern blotting (2.4 kb transcript)	15033535 (Serizawa et al., Gene 2004, 329:125-136); 9141694 (Yamamoto et al., Microbiology 1997, 143(Pt.4):1317-1320); BSORF
yfmR	yfmR	810775..810815	-18.1	AAAAA<left>GCGUGGCC</left>GCAGCA<right>GGCCGCGC</right>UUUUUUUCACAUAAU	Northern blotting	BSORF; Genbank D86418
yfmQ	yfmQ	811360..811406	-12.4	UGAAA<left>GACGGGUGC</left>UGUAU<right>GCUGCUCGUC</right>UUUUUUAUUGUUUUU	Northern blotting	BSORF; SubtiList
yfmP,yfmO	yfmPO	813145..813192	-15.5	CGAAA<left>GACACUGC</left>GCAUAU<right>GCAGUGUC</right>UUUUUAUUCGUUAUA	proposed	14663075 (Gaballa et al., Microbiology 2003, 149(Pt.12):3413-3421); SubtiList	Northern blotting results in BSORF show a yfmP, a yfmO, and a yfmPO transcript. Genbank D86418 and SubtiList show a terminator AAAAGTTTGTT<left>AAACGCTA</left>TTTTTG<right>TAGCGTTT</right>CTTTTAATGGAATAAAGATGGAGGTTAG between yfmP and yfmO at 811899..811959.
yfmM	yfmM	813670..813730	-16.4	AAAAA<left>CCCGCCU</left>GCUAAA<right>GGGCGGG</right>UUUUUUACUGCCAUU	Northern blotting	BSORF; Genbank D86417
yfmL	yfmL	816561..816609	-8.7	AAGAA<left>GGGC</left>GAAGA<right>GCCC</right>UUUUUUUGUUGUAAA	Northern blotting	BSORF; Genbank D86417
yfmK	yfmK	817103..817147	-17.0	CAAAA<left>GGAGGGC</left>AAAAA<right>GCCCUCC</right>CGUUUUCAUCUUCAUUC	Northern blotting	BSORF; Genbank D86417
yfmI,yfmJ	yfmIJ	816779..816843	-15.7	AAACG<left>GGAGGGC</left>UUUUU<right>GCCCUCC</right>UUUUGUGUUUCGAUG	Northern blotting	BSORF	The Northern blotting results in BSORF suggest the existence of an internal promoter in front of yfmJ.
yfmH	yfmH	ND	ND	ND	Northern blotting	BSORF
yfmG	yfmG	821716..821764	-19.2	UUCAG<left>CUUGUAGAAAAAAC</left>AAU<right>GUUUUUUCUACAAG</right>AUUUUAUUUUAAAUGC	Northern blotting	BSORF; Genbank D86417
yfmD,yfmE,yfmF	yfmDEF	ND	ND	ND	Northern blotting	BSORF	Northern blotting results in BSORF show the following transcripts in this region: yfmDEF, yfmCDEF, yfmC, yfmBC, yfmB 
yfmC,yfmD	yfmCD	ND	ND	ND	proposed	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629)	Northern blotting results in BSORF show the following transcripts in this region: yfmDEF, yfmCDEF, yfmC, yfmBC, yfmB 
yflT	yflT	827135..827185	-8.4	CAAAA<left>GGCC</left>AAUGUC<right>GGCC</right>UUUUGGUUUUUUUGC	Northern blotting	BSORF; Genbank D86417
pel	pel	828581..828636	-12.4	AAAAA<left>CACAAAGG</left>GUGCUAA<right>CCUUUGUG</right>UUUUUUAAUUAAUUA	Northern blotting (1.3 kb transcript)	8262178 (Nasser et al., FEBS Lett. 1993, 335(3):319-326); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); SubtiList	Northern blotting results in BSORF also show a pel-yflS trancript.
yflS	yflS	830143..830193	-12.6	AAAAA<left>GGCAGAC</left>GCG<right>GUCUGCC</right>UUUUUUUAUUUUCAC	Northern blotting (1.45 kb transcript)	12949159 (Tanaka et al., Microbiology 2003, 149(Pt.9):2317-2329); Genbank D86417	Northern blotting results in BSORF also show a pel-yflS trancript.
citS,citT,yflP	citST-yflP	833501..833552	-8.9	UAAAA<left>UCCCG</left>ACAUCC<right>CGGGA</right>UUUUUUUCAUGCCGA	Northern blotting	BSORF	Yamamoto et al. (10972810) propose a citST operon.
citM,yflN	citM-yflN	835855..835899	-15.8	UUUGA<left>CACCCGC</left>ACCAC<right>GCGGGUG</right>UUUUUUAUUGUUUUC	Northern blotting (2.4 kb transcript)	10972810 (Yamamoto et al., Mol. Microbiol. 2000, 37(4):898-912)	Northern blotting results in BSORF also show a monocistronic yflN transcript.
yflL	yflL	836764..836827	-11.1	UCAGC<left>GGCGAUGCCG</left>AUCA<right>CGGACGCU</right>ACUUUUUUGAGCUUGUC	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF
yflM,yflK	yflMK	838077..838122	-19.8	AAAAA<left>GCCGCGCAU</left>AUCAAC<right>GUGCGCGGC</right>UUUGCCAUAUUUAAG	Northern blotting; downstream genes are on the opposite strand	BSORF; SubtiList	Note that the gene yflL is located between yflM and yflK, but on the opposite strand.
nagP	nagP	841337..841389	-22.0	AAAAA<left>GCGGAGAGG</left>GCAA<right>CCUCUCCGC</right>UUUUUCUUAUUUAUC	Northern blotting	10627040 (Reizer et al., Microbiology 1999, 145(Pt.12):3419-3429); BSORF; Genbank D86417	bidirectional terminator
yflE	yflE	841346..841406	-18.4	AAAAA<left>GCGGAGAGG</left>UUGC<right>CCUCUCCGC</right>UUUUUUAUUUGACAG	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF; Genbank D86417	bidirectional terminator
yflA	yflA	845490..845532	-7.1	AUACA<left>UGGCU</left>UUCG<right>GGUCG</right>AUUUUUGAGUGUAAAA	Northern blotting; downstream genes are on the opposite strand	BSORF
treP,treA,treR	trePAR	853592..853645	-16.8	GAGAG<left>GCGCCUGCC</left>UGC<right>GGCAGCGCGC</right>UUUUUUGUUUGGUAU	Northern blotting	8755887 (Schock et al., J. Bacteriol. 1996, 178(15):4576-4581); 8917076 (Schock & Dahl, Gene 1996, 175(1-2):59-63); BSORF	Schock measured a trePA (3.2 kb) and a trePAR (more than 4 kb; weak) transcript. The short transcript was hybridized to a treA probe only; it was identified as a trePA transcript based on its length. Northern blotting results in BSORF show a trePAR, a treAR, and a treR transcript. Schock proposed the terminator CAGCGCGC<left>TTTTTTGTTTGGTATCA</left>AAAT<right>TGATACTATCCAACAAA</right>AATGTGCGTACTTTTACTTTTTATCATAATGGCTACAATAGAGA (dG = -10.6 kcal/mole) at position 853628..853717; the indicated terminator was identified by mfold.
yfkO	yfkO	854402..854454	-20.8	AAGAA<left>AGCUGCUCGC</left>AUA<right>GCGAGCAGCU</right>CUUUUUUAUGCCUGAU	Northern blotting	BSORF
yfkM	yfkM	859590..859636	-17.8	AAAAA<left>CGGACGCU</left>CUUG<right>GGCGUCCG</right>UUUUUUUGUUGCUUA	Northern blotting; upstream and downstream genes are on the opposite strand	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); BSORF; SubtiList
yfkJ,yfkI,yfkH	yfkJIH	863149..863199	-22.1	UAAAA<left>GCCUCCUGACA</left>UGA<right>UGUCGGGAGGC</right>UUUUUGAUUAAGAAG	Northern blotting	BSORF
yfkF	yfkF	863157..863220	-17.8	AAAAA<left>GCCUCCCGACA</left>UCA<right>UGUCAGGAGGC</right>UUUUAUGCUAAUGGU	Northern blotting	BSORF; SubtiList
yfkE,yfkD	yfkED	866451..866501	-13.6	AAAAA<left>CUGAUUCC</left>AACUC<right>GGAAUCAG</right>UUUUUUUGUUUAUUG	Northern blotting	BSORF; Genbank D83967	bidirectional terminator
yfkA,yfkB,yfkC	yfkABC	866460..866515	-13.5	AAAAA<left>CUGAUUCC</left>GAGUU<right>GGAAUCAG</right>UUUUUUAUUUAUCUU	Northern blotting	BSORF; Genbank D83967	Northern blotting results in BSORF suggest that an internal promoter exists in front of yfkB. Bidirectional terminator.
yfjT	yfjT	868776..868822	-8.3	UAAAA<left>CCGCG</left>UGCCCGC<right>CGCGG</right>UUUUUUUAUUGGCAU	Northern blotting	BSORF; Genbank 83967
yfjS	yfjS	869674..869728	-14.1	AAAGA<left>CCUCUCC</left>UUAAAC<right>GGAGAGG</right>CUUUUCUUUAUUUUAU	Northern blotting (0.8 kb transcript)	12374835 (Fukushima et al., J. Bacteriol. 2002, 184(21):6007-6015); BSORF; Genbank D83967	bidirectional terminator
yfjR	yfjR	869684..869728	-16.8	GAAAA<left>GCCUCUCC</left>GUUUAA<right>GGAGAGGU</right>CUUUCUCUUUUACAAA	Northern blotting	BSORF; Genbank D78509	bidirectional terminator
yfjQ	yfjQ	870654..870703	-11.4	AAUGA<left>GGACAGC</left>GAGCA<right>GCUGUUC</right>UUUUUUGUUGUAAGC	Northern blotting	BSORF; SubtiList
yfjP,yfjO	yfjPO	874163..874222	-21.8	AAUAA<left>GACCUGGAUUUCGGUAA</left>AAUAAACAA<right>UUCCGAUUUCCGGGUC</right>UUUUUCGUGCGCAGC	Northern blotting	BSORF
yfjN	yfjN	876801..876841	-15.2	AAUAA<left>ACCUGGAUUU</left>UCGGU<right>AAAUCCGGGU</right>CUUUUUUGUACGCAGC	Northern blotting	BSORF; SubtiList
yfjM,yfjL	yfjML	878134..878171	-11.7	UCAAA<left>GGCCGGGU</left>GAU<right>AUCCGGUC</right>UUUUUUUUGCAUGCU	Northern blotting	BSORF; Genbank D78509
acoA,acoB,acoC,acoL	acoABCL	882967..883024	-18.5	AAAAA<left>GCAGGCGC</left>AUGGAUAUAAG<right>GCGCCUGC</right>UUUUUUAUUGUUGAA	Northern blotting; transcriptional fusions	11274109 (Ali et al., J. Bacteriol. 2001, 183(8):2497-2504)	Transcriptional fusions showed that the downstream acoR does not belong to the acoABCL operon. However, Northern blotting results in BSORF show an acoABCLR-sspH transcript, an acoR-sspH transcript, and a monocistronic sspH transcript, but no acoABCL transcript.
acoR	acoR	ND	ND	ND	5' primer extension analysis of the downstream sspH gene; transcriptional fusions to acoR and the upstream acoABCL operon; Northern blotting	10333516 (Cabrera-Hernandez et al., Gene 1999, 232(1):1-10); 11274109 (Ali et al., J. Bacteriol. 2001, 183(8):2497-2504); BSORF	Northern blotting results in BSORF show an acoABCLR-sspH transcript, an acoR-sspH transcript, and a monocistronic sspH trancript, but no acoABCL transcript.
sspH	sspH	885129..885182	-14.9	AAAAA<left>UGGCCCGCUU</left>CAU<right>AAGCAGGCCA</right>UUUUGUUAUCCGCGC	downstream gene is transcribed in the opposite direction	10333516 (Cabrera-Hernandez et al., Gene 1999, 232(1):1-10)	Bidirectional terminator. Northern blotting results in BSORF show an acoABCLR-sspH transcript, an acoR-sspH transcript, and a monocistronic sspH trancript, but no acoABCL transcript.
yfjA,yfjB,yfjC,yfjD,yfjE,yfjF	yfjABCDEF	885142..885189	-19.3	CAAAA<left>UGGCCUGCUU</left>AUG<right>AAGCGGGCCA</right>UUUUUGUUUAAUCCU	Northern blotting	BSORF; SubtiList	Bidirectional terminator. Northern blotting results in BSORF suggest the existence of an internal promoter upstream of yfjC.
malA,yfiA,malP	malA-yfiA-malP	893122..893166	-13.4	GACUG<left>CCCUCCU</left>UUUC<right>GGGAGGG</right>UUUUCGUUUGCCGUC	Northern blotting (3.8 kb transcript)	11489864 (Yamamoto et al., J. Bacteriol. 2001, 183(17):5110-5121); Genbank D50543	Readthrough terminator exists downstream of malA, leading to a 1.4 kb transcript.
yfiB,yfiC	yfiBC	896750..896799	-13.5	AAAUA<left>GACCUUUGU</left>CCUGC<right>ACAGAGGUC</right>UUUUUUUGUUACAGU	Northern blotting	BSORF	Northern blotting results in BSORF suggest the existence of an internal promoter downstream of yfiB.
yfiD,yfiE	yfiDE	898195..898247	-24.0	UGCAA<left>UCCCCUUGCCG</left>AAAUAA<right>CGGCAGGGGGA</right>UUUUUUAUUUUUGUC	Northern blotting	BSORF; Genbank D50543
yfiF	yfiF	ND	ND	ND	Northern blotting	BSORF
yfiG,yfiH,yfiI	yfiGHI	903030..903072	-16.2	AUGCG<left>CCGCAUAUGAC</left>AUAAA<right>GUUCAUAUGCGG</right>UUUUUAUUUUCCAGA	Northern blotting	BSORF; SubtiList	Northern blotting results in BSORF suggest the existence of internal promoters upstream of yfiH and yfiI.
yfiJ,yfiK	yfiJK	905022..905063	-8.9	GAAAA<left>GGCCU</left>UUUAC<right>AGGCC</right>UUUUUUUCAUGCCCU	Northern blotting	8973323 (Yamamoto et al., Gene 1996, 181(1-2):147-151); BSORF; Genbank D78508
padR	padR	908458..908503	-15.2	AAAAA<left>CAUCUGCC</left>UAAAC<right>GGCAGAUG</right>UUUUUUAGGCUCGGA	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF	synonym: yfiO
lipB	lipB	909968..910034	-11.2	AACAA<left>CCUGCUGU</left>CUCCGUU<right>ACAGUGGG</right>UUUUUUCGUCUGAGA	Northern blotting	BSORF; Genbank D78508
yfiQ	yfiQ	911263..911300	-21.9	AACAA<left>GCGGCAGGA</left>GGGC<right>UCCUGCCGC</right>GUUUCUUUACUUCUCA	Northern blotting	BSORF; Genbank D85082	bidirectional terminator
yfiS,yfiR	yfiSR	911264..911308	-20.0	GAAAC<left>GCGGCAGGA</left>GCCC<right>UCCUGCCGC</right>UUGUUUUUCACCCUG	Northern blotting	BSORF; Genbank D85082	Bidirectional terminator. Northern blotting results in BSORF suggest the existence of an internal promoter upstream of yfiR.
yfiT	yfiT	913890..913931	-7.7	UUCAG<left>GAACG</left>GGAAUG<right>CGUUC</right>GAUUUGUUCUUGUAAAG	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF
yfiU	yfiU	ND	ND	ND	Northern blotting; downstream gene is on the opposite strand	BSORF
yfiV	yfiV	915412..915454	-17.3	AGUAA<left>GUCUGUCAUCCGCA</left>AAC<right>UGCGGGAGCAGGC</right>UUUUUUUAUUUGACA	Northern blotting; upstream gene is on the opposite strand	BSORF; SubtiList
yfiW,yfiX	yfiWX	918660..918705	-19.0	AAAAA<left>GACUCCGUCU</left>AAUA<right>AGACGGAGUC</right>UUUUUUUAUUUCGUU	Northern blotting	BSORF; Genbank D85082	bidirectional terminator
yfiY	yfiY	918664..918717	-18.4	AAAAA<left>GACUCCGUCU</left>UAUU<right>AGACGGAGUC</right>UUUUUUGCUUUUGCC	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF; Genbank D85082	bidirectional terminator
yfiZ,yfhA	yfiZ-yfhA	921830..921880	-15.9	UUACA<left>CCCAUUUUCUU</left>AAAA<right>AAGAAAAUGGG</right>UUUUUUUGAUAAUGA	Northern blotting	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); BSORF; Genbank D85082
yfhB	yfhB	ND	ND	ND	ND	ND	Northern blotting results in BSORF show a yfhB, a yfhC, and a yfhBC transcript.
yfhC	yfhC	923497..923544	-23.5	AAAAA<left>CCCCUUGUCUC</left>AAACG<right>GAGACAAGGGG</right>UUUUUCAUUAACGAG	downstream genes are on the opposite strand	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); SubtiList	Bidirectional terminator. Northern blotting results in BSORF show a yfhB, a yfhC, and a yfhBC transcript.
yfhF,yfhE,yfhD	yfhFED	923501..923557	-22.1	AAAAA<left>CCCCUUGUCUC</left>CGUUU<right>GAGACAAGGGG</right>UUUUUUACAUUUCAG	Northern blotting	BSORF; Genbank D85082	Bidirectional terminator. Northern blotting results in BSORF show a yfhFED, a yfhED, and a monocistronic yfhE transcript.
yfhG,yfhH	yfhGH	926080..926117	-14.8	AACAG<left>GAGGCUGA</left>UGA<right>UCAGCCUC</right>UUUUUGUUUGCAGCA	Northern blotting	BSORF; Genbank D85082	BSORF shows a yghGH and a monocistronic yfhH transcript, suggesting that an internal promoter exists upstream of yghH.
yfhI	yfhI	927411..927449	-15.8	AAAAA<left>CAGCUGCA</left>GUGUA<right>UGCAGCUG</right>UUCUUCUUUACCGUU	Northern blotting	BSORF; Genbank D85082
sspK	sspK	927413..927457	-15.2	AAGAA<left>CAGCUGCA</left>UACAC<right>UGCAGCUG</right>UUUUUUACCCUUUAU	upstream and downstream genes are transcribed in the opposite direction	10806362 (Cabrera-Hernandez, Gene 2000, 248(1-2):169-181)
yfhK,yfhL,yfhM	yfhKLM	929913..929969	-11.6	CAUCC<left>GUCUGUCA</left>UAA<right>UGGCAGAC</right>UUUUUCUGUGCGUUU	Northern blotting (1.8 kb transcript)	 10913081 (Antelmann et al, J. Bacteriol. 2000, 182(16):4478-4490)	Internal promoters in front of yfhL and yfhM, leading to a 1.2 kb and a 0.9 kb transcript, respectively. SubtiList and Genbank D85082 list a terminator after yfhK, but none after yfhM. Northern blotting results in BSORF show a yfhK, a yfhLM, and a yfhKLM transcript. Huang (9987136) found a sigW-dependent promoter in front of yfhL; the promoter in front of yfhM has not yet been identified.
csbB	csbB	931248..931285	-5.6	ACCAA<left>GCGCC</left>AUU<right>GGCAGU</right>GCUUUUUUUGCGUGUCU	proposed	8921856 (Akbar & Price, Gene 1996, 177(1-2):123-128)	Northern blotting results in BSORF show a csbB, a csbB-yfhO, and a yfhO transcript. Posisbly due to a sequencing error, Akbar & Price suggest a slightly different terminator.
yfhO	yfhO	933772..933818	-15.6	AAAAA<left>GCCCGGCUCU</left>AUAU<right>AGAGCCGAGC</right>UUUAAUUUUUUCUGA	proposed; downstream gene is on the opposite strand	Genbank D85082	bidirectional terminator
yfhP	yfhP	933775..933829	-20.2	UUAAA<left>GCUCGGCUCU</left>AUAU<right>AGAGCCGGGC</right>UUUUUACGUCUUAUA	Northern blotting (1.1 kb transcript)	10463184 (Yamamoto et al., Microbiology 1999, 145(Pt.8):2171-2180); BSORF	bidirectional terminator
yfhQ,fabL,sspE	yfhQ-fabL-sspE	937484..937542	-14.5	AAAAA<left>GCACUUCAUC</left>UUCG<right>GGUGGAAGUGC</right>UUUUUUCUGUUUGAA	Northern blotting (2.6 kb transcript)	3106326 (Hackett & Setlow, J. Bacteriol. 1987, 169(5):1985-1992); 10463184 (Yamamoto et al., Microbiology 1999, 145(Pt.8):2171-2180); BSORF	The gene yfhS is located between yfhQ and fabL on the opposite DNA strand. Internal promoter in front of sspE, leading to a 0.3 kb transcript. Two internal promoters in front of fabL, leading to a 1.5 kb and a 1.3 kb transcript. A readthrough terminator TGGAAGATGGCAGGAGA<left>AGCAGCCG</left>CCATCT<right>CGGCTGCT</right>CCGTAAACCATTCTTAATCGTAAGAGACGC is located at 936056..936124 downstream of yfhQ, leading to a 1.2 kb transcript.
yfhS	yfhS	936048..936092	-8.8	AGCAA<left>UGAGC</left>UGUUCAC<right>GCUCA</right>GUUUUGAUCCCUUUUU	Northern blotting (0.3 kb transcript)	10463184 (Yamamoto et al., Microbiology 1999, 145(Pt.8):2171-2180); BSORF
perR	perR	944249..944299	-19.8	AAAAA<left>UAAGCUGACCG</left>CACGAAA<right>CGGUCAGCUUA</right>UUUUAUUUCGACAUU	downstream gene is on the opposite strand	12029044 (Fuangthong et al., J. Bacteriol. 2002, 184(12):3276-3286); SubtiList
rrnD-16S,rrnD-23S,rrnD-5S,trnD-Asn,trnD-Ser,trnD-Glu,trnD-Val,trnD-Met,trnD-Asp,trnD-Phe,trnD-Thr,trnD-Tyr,trnD-Trp,trnD-His,trnD-Gln,trnD-Gly,trnD-Cys,trnD-Leu1,trnD-Leu2	rrnD-16S-rrnD-23S-rrnD-5S-trnD-Asn-trnD-Ser-trnD-Glu-trnD-Val-trnD-Met-trnD-Asp-trnD-Phe-trnD-Thr-trnD-Tyr-trnD-Trp-trnD-His-trnD-Gln-trnD-Gly-trnD-Cys-trnD-Leu1-trnD-Leu2	952627..952675	-14.6	GAAAA<left>CCCGUUUCU</left>UAAC<right>AGAAACGGG</right>UUUUUAUUUUUUAUU	Northern blotting; S1 nuclease mapping	6323435 (Wawrousek et al., J. Biol. Chem. 1984, 259(6):3694-3702); 3139657 (Vold et al., J. Biol. Chem. 1988, 263(28):14485-14490)	The Northern blotting experiments showed the position of the terminators, but did not determine if all genes belong to the same operon. A second terminator sequence TTTATTTTTTATTAAA<left>GAAAAGGAGC</left>CTCG<right>GCTCCTTTTT</right>ATACTTACTCAACGTATTGGTCT with dG = -16.2 kcal/mole is located at 952663..952725 immediately downstream of the indicated terminator (Vold et al., 3139657). Internal promoters in front of rrnD-5S and trnD-Leu2. A readthrough terminator downstream of trnD-Leu1 (proposed AACTAATCATATT<left>AATGATCTAC</left>ATAA<right>GTAGATCATT</right>TTTTTAATGCTTTGATTTATCA at 952330..952388 with dG = -13.9 kcal/mole) prevents most transcripts to continue into trnD-Leu2, which is therefore mainly transcribed from its own promoter.
spo0M	spo0M	952676..952716	-8.4	AAAAA<left>GGAGC</left>CGAG<right>GCUCC</right>UUUUCUUUAAUAAAA	upstream and downstream genes are transcribed in the opposite direction	9795118 (Han et al., Gene 1998, 217(1-2):31-40)
senS	senS	958816..958876	-7.2	AAAAA<left>CCCGCUG</left>ACUA<right>CAACGGG</right>UUUUUGCAUUUCUCC	upstream and downstream gene are on the opposite strand	Genbank M34826	bidirectional terminator
katA	katA	958825..958874	-10.6	AAAAA<left>CCCGUUG</left>UAGU<right>CAGCGGG</right>UUUUUUUAUAUUUAG	upstream and downstream genes are on the opposite strand	SubtiList	bidirectional terminator
yhbF	yhbF	972146..972202	-18.5	AAAAA<left>GGGUGCUCU</left>UUCA<right>GGAGCACCC</right>UUUUUUAUUCUUUUC	proposed	8626065 (Fischer et al., Gene 1996, 168(1):55-60)
prkA	prkA	974377..974425	-19.2	AACGU<left>GACCCGUCC</left>GAAUA<right>GGGCGGGUU</right>AUUUUGUCCCAUUUUC	proposed	8626065 (Fischer et al., Gene 1996, 168(1):55-60)
yhbH	yhbH	975725..975778	-7.8	GAAAA<left>GCCC</left>AUUUCA<right>GGGC</right>UUUUUUUUAUUUAAU	proposed	9579061 (Noback et al., Microbiology 1998, 144(Pt.4):859-875); Genbank Y14082
yhcH	yhcH	ND	ND	ND	ND	ND
cspB	cspB	983550..983596	-17.5	AAAAA<left>CUGCAGGU</left>GCAA<right>ACCUGCAG</right>UUUUUAUUUUGACAA	proposed	1400185 (Willimsky et al., J. Bacteriol. 174(20): 6326-6335, 1992)	An alternative putative terminator is AAAAA<left>GCUGUUUUGC</left>AUAA<right>GCAAAACAGC</right>UUUUUUUAUUAGUUU (dG = -16.9 kcal/mole) located at 983503..983546.
yhcN	yhcN	988911..988964	-16.1	AAGAA<left>GCCGCACA</left>AUU<right>UGUGCGGC</right>UUUUUCUUUGCGUUA	proposed	9611260 (Bagyan et al., Gene 1998, 212(2):179-188); Genbank X96983
yhxA,glpP	yhxA-glpP	1001713..1001815	-30.9	C<left>GGAGACCACAGCAGCTCTTTACGG</left>CAAATGTTTATGCAC<right>CCGTAAAGCGGTTTGTTGTGGTTTTT</right>TTATTCTCTTCTTCTCTATCATGCTTTTTAATCGTGA	Northern blotting (1.8-2.1 kb transcript)	2127799  (Holmberg et al., J. Gen. Microbiol. 136:2367-2375, 1990); 8436953 (Beijer et al., J. Gen. Microbiol. 139(Pt.2):349-359, 1993); 1479885 (Holmberg & Rutberg, Mol. Microbiol. 1992, 6(20):2931-2938)	This terminator also functions as a terminator/anti-terminator for transcription of glpFK. Readthrough may occur. mfold calculations shows that TGT and GCA in the loop might form base-pairs, leading to dG = -32.3 kcal/mole.
glpF,glpK	glpFK	1004212..1004268	-37.5	GAGGA<left>GAGACCACAGCACCAAAGUGUA</left>AGCA<right>UGCACUUUGGCUGUUGUGGUCUC</right>UUUUUCUAUUUACCG	Northern blotting (2.4 kb transcript); S1 nuclease mapping of the 3' end	2127799  (Holmberg et al., J. Gen. Microbiol. 136:2367-2375, 1990); 8436953 (Beijer et al., J. Gen. Microbiol. 139(Pt.2):349-359, 1993); 1809833 (Holmberg & Rutberg, Mol. Microbiol. 5(12):2891-2900, 1991); 1479885 (Holmberg & Rutberg, Mol. Microbiol. 1992, 6(20):2931-2938)	Readthrough at this terminator leads to a 4.4 kb glpFKD transcript. This terminator also functions as a terminator/anti-terminator for transcription starting from the glpD promoter. S1 nuclease mapping of the 3' mRNA end shows that transcription ends in the TGGTCTCT section just in front of the T-stretch.
glpD	glpD	1005968..1006012	-13.5	CAUAA<left>CGGGCUG</left>UCUG<right>CAGCCCG</right>UUAUUUCUUUUUACG	Northern blotting (1.8 kb transcript); S1 nuclease mapping of the 3' end	2127799  (Holmberg et al., J. Gen. Microbiol. 136:2367-2375, 1990); 8436953 (Beijer et al., J. Gen. Microbiol. 139(Pt.2):349-359, 1993); 1809833 (Holmberg & Rutberg, Mol. Microbiol. 5(12):2891-2900, 1991); 1479885 (Holmberg & Rutberg, Mol. Microbiol. 1992, 6(20):2931-2938)	The Northern blotting experiment showed a 4.4 kb glpFKD transcript due to readthrough of the glpFK terminator. A primer extension analysis revealed the existence of a promoter in front of glpD, which is the major promoter for glpD transcription. The S1 nuclease mapping results show that transcription ends in the section CCGTTATTTC.
lytF	lytF	1011034..1011085	-18.5	AGAAA<left>CUGUGCGGCC</left>UUAAC<right>GGCUGUACAG</right>UUUUUAUUAGAGCCU	Northern blotting (1.5 kb transcript)	10322020 (Ohnishi et al., J. Bacteriol. 1999, 181(10):3178-3184); 10206711 (Margot et al., Microbiology 1999, 145(Pt.1):57-65)
yhdE	yhdE	1012672..1012728	-11.2	AAAAU<left>GAAGGAAU</left>AGAUUAAG<right>AUUCCUUC</right>UUUUUUUAUGCCCUU	proposed	10322020 (Ohnishi et al., J. Bacteriol. 1999, 181(10):3178-3184); 10206711 (Margot et al., Microbiology 1999, 145(Pt.1):57-65); Genbank Y14079
spoVR	spoVR	1016326..1016368	-13.3	AAAGA<left>GGAUGCAG</left>CGUU<right>CUGCAUCC</right>UUUUUAUUUUCCAGU	proposed; upstream and downstream gene are on the opposite strand	8144469 (Beall & Moran, J. Bacteriol. 1994, 176(7):2003-2012)	bidirectional terminator
phoA	phoA	1016332..1016380	-16.8	UAAAA<left>AGGAUGCAG</left>AACG<right>CUGCAUCCU</right>CUUUUUUAUAAAUAUC	proposed; upstream and downstream gene are on the opposite strand	8144469 (Beall & Moran, J. Bacteriol. 1994, 176(7):2003-2012)	bidirectional terminator
lytE	lytE	1019309..1019353	-13.3	GAAAA<left>CCCGUUC</left>AUUG<right>GAACGGG</right>UUUUUUUCAUUAGAC	transcriptional fusion; Northern blotting (1.1 kb transcript)	9573210 (Ishikawa et al., J. Bacteriol. 1998, 180(9):2549-2555); Genbank Y14082	bidirectional terminator
citR	citR	1019317..1019367	-11.9	AAAAA<left>CCCGUUC</left>CAAU<right>GAACGGG</right>UUUUCUCUAAAAAUU	proposed	8045898 (Jin & Sonenshein, J. Bacteriol. 176(15), 4669-4679, 1994)	bidirectional terminator
citA	citA	ND	ND	ND	proposed	8045898 (Jin & Sonenshein, J. Bacteriol. 176(15), 4669-4679, 1994)
yhdF	yhdF	1022397..1022443	-9.3	AAAAA<left>CCAGCU</left>CAAG<right>AGCUGG</right>UUUUUUGUGUGGUGA	ND	ND
yhdG	yhdG	1024050..1024100	-18.3	AUAAA<left>GAGAGCGGCC</left>AUACA<right>GGCCGCCUC</right>UUUUCUGUUCUUGGC	Northern blotting (1.5 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); Genbank Y14082
yhdJ	yhdJ	1027506..1027543	-15.9	AAAAA<left>GACGCCU</left>GAAA<right>AGGCGUC</right>UUUUUUAAAAGCCAA	proposed	Genbank Y14082	bidirectional terminator
sigM,yhdL,yhdK	sigM-yhdLK	1027510..1027553	-12.6	AAAAA<left>GACGCCU</left>UUUC<right>AGGCGUC</right>UUUUUUCGUUAUACC	Northern blotting (1.9 kb transcript)	10216858 (Horsburgh & Moir, Mol. Microbiol. 1999, 32(1):41-50); Genbank Y14082	same as yhdJ
yhdN,yhdO	yhdNO	1031320..1031374	-8.1	GAAAA<left>GCACC</left>CUAUACAA<right>GGUGC</right>UUUUCUUAUUAUGCU	Northern blotting (1.8 kb transcript)	10220166 (Petersohn et al., Microbiology 1999, 145(Pt.4):869-880); Genbank Y14082	Termination at a readthrough terminator AAATATAA<left>CAAAAGCTGAGGG</left>CGAA<right>TCCTCAGCTTTTTG</right>GCGTTTAAACGAGAG with dG = -18.5 kcal/mole at position 1030561..1030614 between yhdN and yhdO leads to a 1.2 kb transcript.
nhaX	nhaX	1043652..1043702	-15.8	GUAAA<left>GUGAGCAC</left>GCCCU<right>GUGCUCAC</right>UUCUUUUAUAUUCAU	ND	ND	synonym: yheK
sspB	sspB	1049289..1049332	-20.2	CUAUA<left>GAGGGCGCGG</left>UUU<right>CCGCGCUCUC</right>UUUAUUUUGUCACCC	Northern blotting (0.35 kb transcript)	3009398 (Connors et al., J. Bacteriol. 1986, 166(2):417-425)
yhaX	yhaX	1056863..1056919	-22.5	AAAAA<left>GCCGCUCGCGCC</left>CUGACA<right>GGUGCGGCGGC</right>UUUUUUGCCGGAUUG	proposed	10498703 (Homuth et al., J. Bacteriol. 1999, 181(19):5922-5929)
hemZ	hemZ	1058470..1058515	-17.1	ACAAA<left>GCAGCACUG</left>AUUA<right>CAGUGCUGC</right>UUUUUUUAUCCCUGU	Northern blotting (1.6 kb transcript)	10498703 (Homuth et al., J. Bacteriol. 1999, 181(19):5922-5929)
hpr	hpr	ND	ND	ND	downstream gene is on the opposite strand	3131303 (Perego & Hoch, J. Bacteriol. 1988, 170(6):2560-2567)
yhaG	yhaG	1073909..1073959	-14.6	CAAAA<left>CCUCUUCCG</left>CUUC<right>CGGGAGAGG</right>UUUUUUUGAACAGAG	proposed	10735881 (Sarsero et al., J. Bacteriol. 2000, 182(8):2329-2331)
yhgC	yhgC	1082504..1082538	-17.1	GAAUA<left>GCUGCCGG</left>CAUGU<right>CCGGCAGC</right>UUAUUUUAUUGGGAG	proposed	8335642 (Popham & Setlow, J. Bacteriol. 1993, 175(15):4870-4876)
pbpF	pbpF	ND	-6.3	CAAAA<left>UUGUUUUCC</left>UCUUAAU<right>GGAAUUCGG</right>CGAUUUUUUGAACUUUGA	Northern blotting of downstream hemEHY operon	1459957 (Hansson & Hederstedt, J. Bacteriol. 1992, 174(24):8081-8093)
hemE,hemH,hemY	hemEHY	1088885..1088946	-15.0	UAAAA<left>CCUCCGC</left>UUUAUC<right>GCGGAGG</right>UUUUUUUGAUGUGCA	Northern blotting (3.7 kb transcript)	1459957 (Hansson & Hederstedt, J. Bacteriol. 1992, 174(24):8081-8093)
yhfN	yhfN	1103682..1103733	-15.8	AAAAA<left>GAAGCAGGU</left>AUGGAGGA<right>ACCUGCUUC</right>UUUUUACUAUUAUUG	upstream and downstream genes are on the opposite strand	Genbank Y14083	bidirectional terminator
aprE	aprE	1103683..1103740	-15.2	AAAAA<left>GAAGCAGGU</left>UCCUCCAU<right>ACCUGCUUC</right>UUUUUAUUUGUCAGC	upstream and downstream genes are on the opposite strand	Genbank Y14083	bidirectional terminator
yhfQ	yhfQ	1107991..1108045	-14.1	GAAAA<left>GACAGGC</left>AAAC<right>GCCUGUC</right>UUUUUCUUAUUUGAU	downstream genes are on the opposite strand	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); Genbank Y14084
hemAT	hemAT	1111882..1111937	-10.1	AAAAA<left>CCGGUC</left>UGCCAUAC<right>GGCCGG</right>UUUUUUUGCGUUCAU	Northern blotting (1.3 kb transcript)	15033535 (Serizawa et al., Gene 2004, 329:125-136); Genbank Y14084
yhfW	yhfW	1113325..1113376	-9.6	UAAAC<left>CGUUCAU</left>UUUA<right>AUGAACG</right>UUUUUUCAAAUAUUU	proposed	15033535 (Serizawa et al., Gene 2004, 329:125-136); Genbank Y14084
yhxC	yhxC	1115861..1115895	-15.7	AAAAA<left>GCCAAUCCU</left>UGA<right>AGGAUUGGC</right>UUAUUCGCUCUGCUU	proposed	8196543 (Van Sinderen et al., Mol. Microbiol. 11(4): 695-703, 1994)	bidirectional terminator
yhzC	yhzC	1115858..1115898	-15.7	AAUAA<left>GCCAAUCCU</left>UCA<right>AGGAUUGGC</right>UUUUUAUUAUCCGUU	proposed	8196543 (Van Sinderen et al., Mol. Microbiol. 11(4): 695-703, 1994)	bidirectional terminator
comK	comK	1116987..1117033	-16.7	AUUAGAAAAAUAGGAA<left>GGAGCUGACC</left>GAACA<right>GGGCAGCUCC</right>UUUCAUAAAGCUAUG	proposed; upstream and downstream gene are on the opposite strand	8196543 (Van Sinderen et al., Mol. Microbiol. 11(4): 695-703, 1994)	bidirectional terminator
yhxD	yhxD	1116990..1117041	-16.1	UGAAA<left>GGAGCUGCC</left>CUGUUC<right>GGUCAGCUCC</right>UUCCUAUUUUUCUAA	proposed; upstream and downstream gene are on the opposite strand	8196543 (Van Sinderen et al., Mol. Microbiol. 11(4): 695-703, 1994)	bidirectional terminator
yhjB	yhjB	1118422..1118470	-14.5	AAAAA<left>GCAAUCUGG</left>ACA<right>CCAGAUUGC</right>UUUUUCUUAUUUACC	downstream gene is on the opposite strand	Genbank Y14081
addB,addA	addBA	1142818..1142858	-25.4	UA<left>GCGAGAUCCAUAAGCUCCG</left>GAAUUUCAGG<right>CGGAGCGGGUCUCGU</right>UUUCU	proposed	1646786 (Kooistra & Venema, J. Bacteriol. 173(12) 3644-3655, 1991)	Terminator contains a stretch of four subsequent mismatches.
sbcD	sbcD	ND	ND	ND	ND	ND
asnO	asnO	1158417..1158480	-19.9	AAGAA<left>GGAUAGAUGAGCA</left>GGGAAAUAUA<right>UGCUCUAUCUAUCC</right>UUUUUUGUACAACAG	Northern blotting (2.0 kb transcript)	10498721 (Yoshida et al., J. Bacteriol. 1999, 181(19):6081-6091); Genbank Z93940
argC,argJ,argB,argD,carA,carB,argF	argCJBD-carAB-argF	1203705..1203751	-14.3	AAAAA<left>CUGCUGAG</left>CCAAA<right>CUCAGCAG</right>UUUUUUUGAUGGCAA	proposed	8025667 (O'Reilly & Devine, Microbiology 140(5), 1023-1025, 1994); 7511775 (O'Reilly et al., Mol. Microbiol. 1994, 11(1):87-98); 9335269 (Ogura et al., J. Bacteriol. 1997, 179(20):6244-6253)
yjzC	yjzC	1203994..1204039	-13.9	AAAAA<left>CCCAAAACA</left>AUAAA<right>UGUUUUGGG</right>UUUUUGGCUUUUUAA	proposed	9335269 (Ogura et al., J. Bacteriol. 1997, 179(20):6244-6253)
med,comZ	med-comZ	1207084..1207136	-11.7	AAGAA<left>GCCACUUU</left>UUUG<right>AAAGUGGC</right>UUUUCACAUGAUUUU	Northern blotting (1.25 kb transcript)	9335269 (Ogura et al., J. Bacteriol. 1997, 179(20):6244-6253)	a transcript starting upstream of yjaU may end at the same terminator
appD,appF,appA,appB,appC	appDFABC	1216463..1216523	-14.9	AAAAA<left>GCAGGUCUCCUUUAGU</left>CAGAAAAUAU<right>ACAAAGAGAUCUGC</right>UUUUUAUGAUUCUUA	proposed	7997159 (Koide & Hoch, Mol. Microbiol. 1994, 13(3):417-426)
oppA,oppB,oppC,oppD,oppF	oppABCDF	1224762..1224804	-20.9	AUCAA<left>UCCUUCAAGAG</left>AUUU<right>CUCUUGAAGGA</right>UUUUUUUGCGUCUUC	Northern blotting (6.0 kb transcript)	1901616 (Perego et al., Mol. Microbiol. 1991, 5(1):173-185); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)	The secondary structure of the RNA corresponding to the oppA-oppB intergenic region may enhance the stability of the mRNA molecule (Perego), or function as a readthrough terminator (1.8 kb oppA transcript found by Yoshida).
yjbC,yjbD	yjbCD	1227409..1227454	-16.8	CAAAA<left>GAAGGCUGA</left>GUCA<right>UCAGCCUUC</right>UUUUAUUUUUCAACC	Northern blotting (1.2 kb transcript)	 10913081 (Antelmann et al, J. Bacteriol. 2000, 182(16):4478-4490); SubtiList
mecA	mecA	1229030..1229071	-15.1	GCAAA<left>CCGAUUUCC</left>UUCC<right>GGAAAUCGG</right>UUUUUUUUAUGCACG	proposed	8412687 (Kong et al., Mol. Microbiol. 1993, 9(2):365-373)
yjbF	yjbF	1230394..1230430	-7.6	GCUGU<left>GAAAGGC</left>ACAAAAGGAAAG<right>GUUUUUC</right>GUGUUUUUACUGCUUUUU	ND	ND
yjbJ	yjbJ	1234446..1234488	-11.8	CGUAA<left>CCAGAGG</left>UGCUCUUUC<right>CCUCUGG</right>UUUUUUUGCGAAGUG	proposed	15033535 (Serizawa et al., Gene 2004, 329:125-136)
tenA,tenI	tenAI	ND	ND	ND	lacZ transcriptional fusions	1898926 (Pang et al., J. Bacteriol. 1991, 173(1):46-54)	The lacZ transcriptional fusions showed that tenA and tenI belong to the same operon. Genes further downstream may also belong to this operon.
yjbX	yjbX	1248657..1248708	-16.6	AAAAA<left>GCUGCCCGGC</left>UGAUGUU<right>GCCGGACAGC</right>UUUUUUUACAUAGAG	downstream gene is in the opposite direction	ND
cotY,cotZ	cotYZ	ND	-11.6	GAAAA<left>GCUUGCA</left>GGCC<right>UGCAGGC</right>UUUUCUCUAUGUAAA	Northern blotting (1.4 kb transcript)	7519271 (Zhang et al., J. Mol. Biol. 1994, 240(5):405-415); 8509331 (Zhang et al., J. Bacteriol. 1993, 175(12):3757-3766)	Zhang et al. proposed the terminator CUUUUCUCUAUGUAAAAAAA<left>GCUGUCCGGC</left>AACAUCA<right>GCCGGGCAGC</right>UUUUUUCUUUUUCGU (dG = -21.6 kcal/mole) at position 1248664..1248721 slightly further downstream. A readthrough terminator or an mRNA processing site ATTACAGGTGCAAATCAT<left>TCAGCTGCTTC</left>CAGCGT<right>GAGGCAGCTGA</right>CTCTCCATCATTT was found downstream of cotY at 1249236..1249294, leading to a 0.6 kb transcript.
cotV,cotW,cotX	cotVWX	1249925..1249966	-13.5	UAAAA<left>GCAGAGC</left>UAAAAAC<right>GCUCUGC</right>UUUUUCUUAUUUUCC	Northern blotting (1.6 kb transcript)	7519271 (Zhang et al., J. Mol. Biol. 1994, 240(5):405-415); 8509331 (Zhang et al., J. Bacteriol. 1993, 175(12):3757-3766)	internal promoter in front of cotX, leading to a 0.6 kb transcript.
yjcI,yjcJ	yjcIJ	1260082..1260126	-17.1	AAAAA<left>GAAGCCGGG</left>GAUAG<right>UCCGGCUUC</right>UUUUAUUAUUGUUCG	Northern blotting (2.5 kb transcript)	11832514 (Auger et al., Microbiology 2002, 148(Pt.2):507-518)
yjcP,yjcQ	yjcPQ	1266705..1266756	-9.1	UAAGA<left>GCAUCC</left>UGCG<right>GGGUGC</right>UUUUUUUGUUCCCUG	Northern blotting (0.8 kb transcript)	15033535 (Serizawa et al., Gene 2004, 329:125-136)
cotT	cotT	1279888..1279930	-12.8	CAAAA<left>UGGGGGC</left>AGUCCA<right>GCUCCCCA</right>UUUUUUUGUUUUAAA	proposed	2546006 (Aronson et al., Mol. Microbiol. 1989, 3(3):437-444)
yjfB	yjfB	1282428..1282490	-16.8	CCAGA<left>GGCGGCCAAGA</left>ACUCCAUCC<right>UCCCGGCCGCC</right>UUUAUUGUUCACAAA	Northern blotting (0.2 kb transcript)	15033535 (Serizawa et al., Gene 2004, 329:125-136); 9579062 (Rivolta et al., Microbiology 1998, 144(Pt.4):877-884)	A 0.8 kb readthrough transcript was also detected.
yjgB	yjgB	1284146..1284193	-11.6	CCUAC<left>GCGGCU</left>AUUC<right>AGCCGC</right>UUUUUUAGUGGACAA	ND	ND
uxaC,yjmB,yjmC,yjmD,uxuA,yjmF,exuT,exuR,uxaB,uxaA	uxaC-yjmBCD-uxuA-yjmF-exuTR-uxaBA	1312111..1312162	-14.6	GAAAA<left>GGCUAUCC</left>UUCAAGC<right>GGAUAGCC</right>UUCUUCAUUAAAUCA	proposed	9882655 (Mekjian et al., J. Bacteriol. 1999, 181(2):426-433); 9579062 (Rivolta et al., Microbiology 1998, 144(Pt.4):877-884)	internal promoter in front of yjmC
yjoB	yjoB	1315024..1315074	-16.7	AGAAA<left>GCACGGGU</left>GUUUGAAAA<right>ACCCGUGC</right>UUUUUUGUUGCGGUU	primer extension of downstream rapA gene	1378051 (Mueller et al., J. Bacteriol. 1992, 174(13):4361-4373)
rapA,phrA	rapA-phrA	1316437..1316474	-8.9	AAAAA<left>GACCC</left>UUAG<right>GGGUC</right>UUUUUUAUUUCUUCA	hybrid formation with RNA probes; nuclease protection experiments	1378051 (Mueller et al., J. Bacteriol. 1992, 174(13):4361-4373); Genbank AF034138
xre	xre	ND	ND	ND	proposed	8083174 (McDonnell et al., J. Bacteriol. 1994, 176(18):5820-5830)
xkdB,xkdC,xkdD,xtrA	xkdBCD-xtrA	1323690..1323741	-34.7	GCCUG<left>CGGACACUGAUCAACUGCACA</left>GCAUU<right>UGUGCGUUGAUUGGUGUCCG</right>UUUUUUAUUUGCCAA	proposed	8083174 (McDonnell et al., J. Bacteriol. 1994, 176(18):5820-5830)
xtmA,xtmB,xkdE,xkdF,xkdG,xkdH,xkdI,xkdJ,xkdK,xkdM	xtmAB-xkdEFGHIJKM	1333564..1333609	-15.6	AUACG<left>CAGACCUUUC</left>UCA<right>GAAAGGUCUG</right>UUUUUUAAAGAUGAA	proposed	2110147 (Wood et al., J. Bacteriol. 1990, 172(5):2667-2674)	Wood et al. assume an operon of at least 19 kb, presumably including the downstream genes xkdNOPQRSTUVWX-xepA-xhlAB-xlyA
htrA	htrA	1357199..1357236	-24.4	AUAAU<left>GCCUCAGGCCGU</left>AAAA<right>GCGGUCUGAGGC</right>UUUUUAUUAGAUAAA	upstream and downstream genes are on the opposite strand	ND
proG	proG	1359570..1359606	-13.6	AACAU<left>GAAUCCUU</left>GAAA<right>GAGGAUUC</right>UUUUUUUAUCACUGA	proposed	1766370 (Mathiopoulos et al., Mol. Microbiol. 5(8):1903-1913, 1991)	synonym: ykeA
dppA,dppB,dppC,dppD,dppE	dppABCDE	1365105..1365163	-17.3	GGAAA<left>UACUGCUUCUUU</left>AUGC<right>GAAGGAGCGGUA</right>UUUUUCCUCUUUCUU	Northern blotting (5.9 kb transcript)	1766370 (Mathiopoulos et al., Mol. Microbiol. 5(8):1903-1913, 1991); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
ykgA,ykgB	ykgAB	1369136..1369191	-20.0	AAAUG<left>GAGUGGCUCU</left>AGUAAAAA<right>GGAGCCACUC</right>UUUUUAUUUAUCUUA	proposed	10482513 (Petersohn et al., J. Bacteriol. 1999, 181(18):5718-5724)
hmp	hmp	1373292..1373341	-12.3	UGAAA<left>CUCUUCUC</left>CUUUCA<right>GAGAAGAG</right>UUUUUUAUUGAGAUA	downstream gene is on the opposite strand	8682784 (LaCelle et al., J. Bacteriol. 1996, 178(13):3803-3808); SubtiList
yklA	yklA	1380699..1380750	-22.8	AAAAA<left>GAGGAUGCCU</left>GUACA<right>AGGCAUCCUC</right>AAUUUUUUUGAUGAAGU	proposed	9696771 (Volker et al., J. Bacteriol. 1998, 180(16):4212-4218)	bidirectional terminator
ykmA	ykmA	1380708..1380762	-19.3	AAAUU<left>GAGGAUGCCU</left>UGUAC<right>AGGCAUCCUC</right>UUUUUAUUUAUUCAG	proposed	9696771 (Volker et al., J. Bacteriol. 1998, 180(16):4212-4218)	bidirectional terminator
ykzA	ykzA	1381740..1381774	-15.1	ACCGG<left>CAUCCUGAG</left>GAUU<right>CUCAGGAUG</right>UUUUUUGGUGUCGGA	Northern blotting (0.5 kb transcript)	9696771 (Volker et al., J. Bacteriol. 1998, 180(16):4212-4218)	readthrough at this terminator leads to 0.8 kb and 1.4 kb transcripts
guaD	guaD	1381947..1381989	-17.7	UAAAA<left>GGAUCAGGC</left>AUGCGCG<right>GCCUGGUCC</right>UUGUUAUUUCUCCAA	downstream gene is on the opposite strand	11101664 (Nygaard et al., Microbiology 2000, 146(Pt.12):3061-3069)
tnrA	tnrA	1396676..1396722	-12.4	UAAAA<left>GUCCGGCUC</left>GCAGUU<right>GAGACGGAC</right>UUUUUACGUUUAUAA	upstream and downstream genes are on the opposite strand	Genbank U55004
ykzB,ykoL	ykzB-ykoL	1397633..1397693	-14.1	AAUUA<left>UCCUUAUACA</left>AGAUAA<right>UGUAUAAGGA</right>UUUUUUUGCUUUUAG	primer extension experiments for both genes	10671441 (Robichon et al., J. Bacteriol. 2000, 182(5):1226-1231)	internal promoter in front of ykoL
sigI	sigI	ND	ND	ND	ND	ND
sspD	sspD	1413051..1413103	-18.3	UCUUU<left>AUUCGCCGGG</left>GGCA<right>CUCGGCGAAU</right>CUUCAUUUUUAGCUGA	downstream gene is transcribed in the opposite direction	3009398 (Connors et al., J. Bacteriol. 1986, 166(2):417-425)
spo0E	spo0E	1430260..1430305	-9.5	AUAAA<left>GAGAGAGCUUU</left>UCG<right>GAAGCGCUC</right>UUUUUUUCUGGAAAA	proposed	2838724 (Perego & Hoch, Mol. Microbiol. 1987, 1(1):125-132)
eag	eag	ND	ND	ND	proposed	2838724 (Perego & Hoch, Mol. Microbiol. 1987, 1(1):125-132)	The terminator GAUAAAAAA<left>CCCUCCUGAC</left>AUG<right>GUCAGGGGGG</right>CUAUGAUGC (dG = -20.0 kcal/mole) proposed by Perego at position 1430762..1430802 lacks a T-stretch.
motA,motB	motAB	1432943..1433003	-15.6	AAAAA<left>GGAAGCCUUGUG</left>ACA<right>UAUCAGGCUUCC</right>UUUUUUUACUUAUUA	Northern blotting (1.6 kb transcript)	6313226 (Gilman & Chamberlin, Cell 1983, 35(1):285-293); 1624413 (Mirel et al., J. Bacteriol. 1992, 174(13):4197-4204)
clpE	clpE	1434888..1434949	-17.7	AAUCA<left>GCGGUUUCCU</left>UUU<right>AGGAAGCCGC</right>UUUUUUUUAUACUUU	proposed	10320580 (Derre et al., Mol. Microbiol. 1999, 32(3):581-593)
ykvI	ykvI	1438620..1438663	-14.7	GACGA<left>GCUGUAUC</left>CUUG<right>GAUACGGC</right>CUUUUUUAUGUUUUUC	proposed	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)
ykvP,ykvQ	ykvPQ	ND	ND	ND	Northern blotting (2.5 kb transcript)	11011148 (Kodama et al., J. Biochem. (Tokyo) 2000, 128(4):655-663)
ykvU,ykvV	ykvUV	1450421..1450473	-14.3	GAAUA<left>GCUGAGAG</left>CAUAGA<right>CUCUCAGC</right>UUUUUUCAUAUAGAG	Northern blotting (2.0 kb transcript)	15292147 (Imamura et al., J. Bacteriol. 2004, 186(16):5450-5459)
ykvW	ykvW	1452574..1452628	-21.6	UAAAA<left>CCAGCAGCCU</left>AAUC<right>AGGCUGCUGG</right>CUUUUUAUGUAUCAAG	proposed	12180919 (Gaballa & Helmann, Mol. Microbiol. 2002, 45(4):997-1005)
ptsG,ptsH,ptsI	ptsGHI	1460669..1460711	-17.9	AAAAA<left>CCAGACGGCC</left>UCC<right>GGCCUGUCUGG</right>UUUUUUUCAUAAGUA	Northern blotting (4.6 kb transcript)	7686067 (Reizer et al., Protein Sci. 1993, 2(4):506-521); 2497294 (Gonzy-Treboul et al., Mol. Microbiol. 1989, 3(1):103-112); 11902727 (Stulke et al., Mol. Microbiol. 1997, 25(1):65-78); 11489127 (Ludwig et al., Mol. Microbiol. 2001, 41(2):409-422)	Internal promoter in front of ptsH, leading to a 2.0 kb transcript.
splA,splB	splAB	1462094..1462141	-16.9	UUAAA<left>CGGGCUGUUG</left>UGAU<right>CAACAGCUCG</right>CUUUUUUAUAAAAAAC	5' primer extension of splB	10629212 (Fajardo-Cavazos & Nicholson, J. Bacteriol. 2000, 182(2):555-560); 8021181 (Pedraza-Reyes et al., J. Bacteriol. 1994, 176(13):3983-3991)
mcpC	mcpC	1464898..1464946	-18.4	UUACA<left>UCCCCAAACA</left>UCAUU<right>UGUUUGGGGA</right>UUUUUUAUUUUAUAA	proposed	9353924 (Muller et al., Microbiology 1997, 143(Pt.10):3231-3240)
kinA	kinA	1471136..1471181	-12.8	AAUAAAAA<left>CAACGGC</left>UUAAAC<right>GCCGUUG</right>UUUAUCGUCUGCAUU	linearized/supercoiled templates; downstream gene is transcribed in the opposite direction	1569009 (Predich et al., J. Bacteriol. 1992, 174(9):2771-2778); 2509430 (Perego et al., J. Bacteriol. 1989, 171(11):6187-6196)
cheV	cheV	1473807..1473861	-18.8	AAAAA<left>CAGCCGUUGCC</left>AGAAAGA<right>GGCACGGCUG</right>UUUUUAUUUUAAAAG	proposed	8169223 (Fredrick & Helmann, J. Bacteriol. 1994, 176(9):2727-2735)	bidirectional terminator
ykyB	ykyB	1473816..1473872	-18.5	AAAAA<left>CAGCCGUGCC</left>UCUUUCU<right>GGCAACGGCUG</right>UUUUUAUUUAUUCAA	proposed	8169223 (Fredrick & Helmann, J. Bacteriol. 1994, 176(9):2727-2735)	bidirectional terminator
ykuD	ykuD	1475806..1475850	-2.5	UCACG<left>AUUA</left>ACCGG<right>UAAU</right>GUUUUCUUAUUUGUUU	Northern blotting (0.9 kb transcript)	11011148 (Kodama et al., J. Biochem. (Tokyo) 2000, 128(4):655-663)
ccpC	ccpC	1486219..1486257	-11.2	UUAAA<left>GACAGC</left>GAGGU<right>GCUGUC</right>UUUUUUUUAUUUAUC	proposed	11985717 (Kim et al., Mol. Microbiol. 2002, 43(2):399-410)
ykuN,ykuO,ykuP	ykuNOP	ND	ND	ND	proposed	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629)
rok	rok	1493656..1493714	-13.0	AAAAA<left>CUGCUUGGC</left>AUC<right>GCUCAAGCAG</right>UUUUUUUAUUGAGGU	proposed	11849533 (Hoa et al., Mol. Microbiol. 2002, 43(1):15-26)
yknT	yknT	1493674..1493724	-13.0	AAAAA<left>CUGCUUGAGC</left>GAU<right>GCCAAGCAG</right>UUUUUCUUUAUAUUU	upstream and downstream genes are in the opposite direction	8990290 (Henriques et al., J. Bacteriol. 1997, 179(2):389-398)
yknW,yknX,yknY,yknZ	yknWXYZ	1506594..1506638	-15.5	AGUAG<left>CCUCAUGCA</left>ACA<right>UGCAUGAGG</right>UUUUUUUAUGUUUAG	proposed	9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371); Genbank AF012285
fruR,fruK,fruA	fruRKA	1510455..1510511	-14.8	AAAAA<left>GCGUCCUU</left>GGUUCGA<right>AAGGACGC</right>UUUUUCUUAUCCGGC	proposed	Genbank AF012285
sipT	sipT	1511177..1511236	-15.7	AAAAA<left>CGCCUUGCUG</left>GCCUAGGA<right>CAGCAGGCG</right>UUUUUAUUUUGAAAA	Northern blotting	9694797 (Tjalsma et al., Genes Dev. 1998, 12(15):2318-2331); Genbank AF012285
abh	abh	1517439..1517498	-15.2	AAAAA<left>GGCGGAGUG</left>AUAU<right>CAUCUCCGCC</right>UUUUUUGCGUGCCAA	proposed	8002614 (LeDeaux and Grossman, J. Bacteriol. 1995, 177:166-175)
kinC	kinC	ND	ND	ND	ND	ND
pdhA,pdhB,pdhC,pdhD	pdhABCD	1532585..1532640	-18.5	AAAAA<left>CAGCCCCGCU</left>UUG<right>AGCGAGGGCUG</right>UUUUUUUAUUUUGAC	Northern blotting (5.2 kb transcript)	1697575 (Hemila et al., J. Bacteriol. 1990, 172(9):5052-5063); 11976308 (Gao et al., J. Bacteriol. 2002, 184(10):2780-2788)	Hemila also found a 2.8 kb pdhCD and a 1.7 kb monocistronic transcript. However, Gao et al. note that promoters were found in front of pdhA and pdhC only; no promoter was found in front of pdhD.
nprE	nprE	1539284..1539345	-12.9	GAAAA<left>GCCUGAG</left>AUCC<right>CUCAGGC</right>UUUUAUUGUUACAUA	proposed	Genbank AF012285
ctaA	ctaA	1557287..1557342	-19.2	CAUAAGGACUCAA<left>GACCAAAGCC</left>UUAGGC<right>GGCUUUGGUC</right>UUUUUUAUGUCUUGU	RNase protection hybridization	2549007 (Mueller & Taber, J. Bacteriol. 171(9): 4979-4986, 1989)	The RNase protection hybridization shows that transcription ends in the TTTGGTCTTTTTT stretch.
ctaB	ctaB	1559595..1559632	-5.0	CCUUGA<left>CCUCUUG</left>UUUAAU<right>CAGGCGG</right>CUUUACUUUUAU	RNAse protection mapping of the 3' terminus of the transcript	9829923 (Liu & Taber, J. Bacteriol. 1998, 180(23):6154-6163)	The RNAse protection mapping of the 3' end showed that transcription ends at the end of the stem-loop. A longer ctaBCDEF transcript was also detected; its origin is unknown.
ylbJ	ylbJ	1569849..1569891	-10.2	UGACAAACGGAACAAAAAAA<left>GGAUGAG</left>UCAAAACC<right>CUCAUCC</right>UUGUCUGAAUUUUUG	upstream and downstream genes are in the opposite direction	Genbank Z98682
yllA	yllA	1579299..1579344	-10.4	AAGAA<left>CCCUGA</left>CUAGU<right>UCAGGG</right>UUUCUUUUUAUGGGU	proposed	8636036 (Daniel et al., J. Bacteriol. 178(8):2343-2350, 1996)
yllB,ylxA,ftsL,pbpB	yllB-ylxA-ftsL-pbpB	1583410..1583436	-12.2	UGAUUAAAAA<left>GAAAGCCGUCGU</left>UAU<right>GCAGGCUUUC</right>UUUUUUUAUGCCUUC	proposed	8636036 (Daniel et al., J. Bacteriol. 1996, 178(8):2343-2350); 8244929 (Yanouri et al., J. Bacteriol. 1993, 175(23): 7604-7606)
spoVD	spoVD	1585439..1585478	-19.3	AAAGG<left>AGGCAGCCGA</left>UUGAU<right>UCGGGCUGCCU</right>AUUCUUUUAUUGCAGA	proposed	8436954 (Daniel & Errington, J. Gen. Microbiol. 139:361-370, 1993)
murE,mraY,murD,spoVE,murG,murB	murE-mraY-murD-spoVE-murG-murB	1592902..1592950	-9.1	ACAAA<left>CGGCAU</left>CAUAGU<right>AUGCCG</right>UUUGUUUUGGAAUAG	proposed	1391053 (Henriques et al., Biochimie 74:735-748, 1992); 8106328 (Harry et al., J. Bacteriol. 176:1172-1179, 1994); 1391053 (Henriques et al., Biochimie 74:735-748, 1992)	Dubious; other proposed (readthrough) terminators are TTGTCTTGAAGTA<left>AATCGGCAGCCCTAA</left>TGACTTTAAGC<right>TTGGGGTGTCGATT</right>GCTTTGACTACTA at 1589661..1589726 downstream of murD; GCTACTCGAGGTATTAA<left>CGAATGTATTTCCAAGCCTCCTG</left>TCTAA<right>CATGAAGCTTGGAAACAATTG</right>ATGCGATAACCCTG at 1590703..1590782 downstream of spoVE; GGAAACAATTGATG<left>CGATAACCCTGT</left>CCAACAAA<right>ACAGGGTTATCG</right>TTATGTTATAGAGAAACTT at 1590856..1590920 downstream of spoVE. Internal promoter in front of spoVE.
divIB	divIB	ND	ND	ND	ND	ND
ftsA,ftsZ	ftsAZ	1598263..1598318	-15.3	CUAAUGUAAA<left>GGACAAAAUCG</left>UUUU<right>CGAUUUUGUCU</right>UUUUUGUUUUUCUCU	Northern blotting (2.5 kb transcript)	1624452 (Gholamhoseinian et al., J. Bacteriol. 1992, 174(14):4647-4656); 1569582 (Gonzy-Treboul et al., J. Mol. Biol. 224:967-979, 1992); 2108961 (Wu et al., J. Biol. Chem. 1990, 265(12):6845-6850)
spoIIGA,sigE,sigG	spoIIGA-sigE-sigG	1605698..1605752	-16.3	GAAAA<left>GCCUUUAAAACG</left>AUGU<right>UGUUUUAAAGGC</right>UUUUCUAUUGAUUAU	promoter probe vectors; integrational plasmids; lacZ transcriptional fusions	2459711 (Masuda et al., Proc. Natl Acad. Sci. USA 1988, 85(20):7637-7641); 1902213 (Sun et al., J. Bacteriol. 1991, 173(9):2977-2984); 2439490 (Kenney & Moran, J. Bacteriol. 1987, 169(7):3329-3339)	internal promoter in front of sigG
pyrR,pyrP,pyrB,pyrC,pyrAA,pyrAB,pyrK,pyrD,pyrF,pyrE	pyrRPBCAAABKDFE	1629281..1629360	-23.3	UAAAG<left>AGGCUUCAAAGCCU</left>UGCUGUACUUGAAAAC<right>AGGCUGUGAGGCCU</right>GUUUUUUUAUUAAUCC	Northern blotting (12 kb transcript)	8206849 (Turner et al., J. Bacteriol. 1994, 176(12):3708-3722); Genbank AJ000974; Genbank M59757	An alternative terminator CCUUGCUGUACUU<left>GAAAACAGGCU</left>GUGA<right>GGCCUGUUUUU</right>UUAU (dG = -20.9 kcal/mole) was found at position 1629306..1629348. Downstream of pyrR at position 1618225..1618289, the stem-loop CAGGTCTTTGTATG<left>CCTCTTTGC</left>GTAAAAAA<right>GCAAAGAGG</right>TTTTTTTATACAGTCATTGAGTCAT was found as part of a terminator-antiterminator structure, leading to a 0.65 kb transcript. Similarly, at position 1619694..1619753 downstream of pyrP, the stem-loop GCCCTCTATTTAACCAT<left>ACCCCGAGTCTA</left>TCT<right>TAGACCGGGGT</right>TTTTTTTCAGCCTTAAG also belongs to a terminator/antiterminator structure, leading to a 2.3 kb transcript. In front of pyrR, another terminator-antiterminator was found.
cysH,cysP,sat,cysC,ylnD,ylnE,ylnF	cysHP-sat-cysC-ylnDEF	1635371..1635423	-19.5	AAUAA<left>GCCAGAGCAU</left>ACAA<right>AUGCUCUGGC</right>UUUUCUUUAUGCGGC	Northern blotting (6.1 kb transcript)	11004190 (Mansilla et al., J. Bacteriol. 2000, 182(20):5885-5892); Genbank AJ000974
spoVM	spoVM	1654841..1654900	-21.8	AUAAA<left>AACGCCUGCC</left>ACAUAUCGG<right>GGCAGGCGUU</right>CAUUUUGUUAUACACGC	downstream gene is in opposite direction	8231808 (Levin et al., Mol. Microbiol. 1993, 9(4):761-771); Genbank Y13937
rnc,smc,ftsY	rnc-smc-ftsY	1670412..1670467	-16.4	AAAAA<left>GGCCCCAA</left>CAUC<right>UUGGGGCC</right>UUUUUCUUUUUUAUC	Northern blotting (5.5 kb transcript)	7584053 (Oguro et al., DNA Res. 1995, 2(2):95-100); 11021934 (Kakeshita et al., Microbiology 2000, 146(Pt.10):2595-2603)	Bidirectional terminator. Internal promoter, 705 bp upstream from the ftsY translation start site, inside the smc gene, leading to a 1.7 kb monocistronic ftsY transcript.
ylqB	ylqB	1670428..1670476	-16.9	AAAAA<left>GGCCCCAA</left>GAUG<right>UUGGGGCC</right>UUUUUCUUAAUCGUC	Northern blotting (0.5 kb transcript)	15033535 (Serizawa et al., Gene 2004, 329:125-136)	bidirectional terminator
ylxM,ffh	ylxM-ffh	ND	ND	ND	5' primer extension of the downstream ffh gene	8335643 (Honda et al., J. Bacteriol. 1993, 175(15):4885-4894)
rpsP,ylqC	rpsP-ylqC	1673422..1673468	-11.9	UAAAA<left>GGGAGAGG</left>GCCGGCA<right>CCUCCCC</right>UUUUUUUACACGCAA	proposed	8335643 (Honda et al., J. Bacteriol. 1993, 175(15):4885-4894)
sucC,sucD	sucCD	1681809..1681859	-20.8	AAAAA<left>AGGGACAGCC</left>GUCAA<right>GGCUGUUCCU</right>GCUUUUUCUAACAAAAG	Northern blotting (2.2 kb transcript)	11976317 (Condon et al., J. Bacteriol. 2002, 184(10):2845-2849); Genbank AJ000975
smf	smf	1682753..1682803	-8.6	ACAAA<left>CGGUAUUGUAAUAUUUAAU</left>AAUAGUGAGG<right>AUUUAAAGUUGCAUAUUG</right>UUUUCUAUUUAAUUA	ND	ND
topA	topA	1685031..1685069	-15.8	GUAGC<left>GGUGAGCAG</left>GGUC<right>UUGCUCACC</right>UUCUUUGUGUGUUAA	proposed	Genbank AJ000975
codV,clpQ,clpY,codY	codV-clpQY-codY	1690179..1690235	-12.2	AAAAA<left>GAACCCUU</left>UUU<right>GAGGGUUC</right>UUUUUUUAUUUCAAA	plasmid integrations and in-frame deletion mutations	7783641 (Slack et al., Mol. Microbiol. 1995, 15(4):689-702)
flgB,flgC,fliE,fliF,fliG,fliH,fliI,fliJ,ylxF,fliK,ylxG,flgE,Bsu1630a,fliL,fliM,fliY,cheY,fliZ,fliP,fliQ,fliR,flhB,flhA,flhF,ylxH,cheB,cheA,cheW,cheC,cheD,sigD,ylxL	fc31	ND	ND	ND	RNAse protection assay; insertional mutagenesis; deletion of the promoter upstream of flgB	15175317 (Werhane et al., J. Bacteriol. 186(12):4025-4029, 2004); 8157612 (Marquez-Magana & Chamberlin, J. Bacteriol. 1994, 176(8):2427-2434); 9657996 (Estacio et al., J. Bacteriol. 1998, 180(14):3548-3555)	Some readthrough into downstream rpsB. The terminator may be factor-dependent. Internal promoters in front of fliH, fliK, fliL, sigD.
ylxS,nusA,ylxR,ylxQ,infB,ylxP,rbfA	ylxS-nusA-ylxRQ-infB-ylxP-rbfA	1736092..1736141	-17.7	AAAGA<left>GAGGAUAGGCG</left>UAUAU<right>CGUCUGUCCUC</right>UUUCUUCGUUUAUAA	Northern blotting (5.2 kb transcript)	8491709 (Shazand et al., J. Bacteriol. 1993, 175(19):2880-2887)	stem-loops AAAGAGTGGGGAAACCCGCTCTTT at 1731015..1731038 and CCCTGCTCTTTTGAAGCAGGG at 1731091..1731111 may have a regulatory function
mlpA	mlpA	1743137..1743179	-17.9	GGAAA<left>GCCUGCCCCA</left>UAA<right>UGGAGCAGGC</right>AUUUUUUAAUCCCUUU	proposed	8098035 (Chen et al., J. Biol. Chem. 268(13), 9448-9465, 1993)
ymxH	ymxH	1743507..1743549	-15.0	UGAAA<left>CAUCGGCU</left>GCCGG<right>AGCCGAUG</right>UUUUUUUAUAUGGAA	proposed	8098035 (Chen et al., J. Biol. Chem. 1993, 268(13):9448-9465)
spoVFA,spoVFB,asd,dapG,dapA	spoVFAB-asd-dapG-dapA	1748548..1748598	-15.6	AAACG<left>CGGUCAUUCUCA</left>CAUUCAGC<right>UGAGUUUGACCG</right>UUUCUUUUACAUAUU	primer extension analysis of dapG and dapA; integrative plasmids	8098035 (Chen et al., J. Biol. Chem. 268(13), 9448-9465, 1993); 8345520 (Daniel & Errington, J. Mol. Biol. 1993, 232(2):468-483)	Internal promoter in front of asd. Second proposed terminator was found in a different section of the genome.
recA	recA	1764966..1765022	-12.8	AAAAG<left>GCUGAGU</left>GAAAA<right>ACUCAGC</right>UUUUUUGUAUUUUGC	ND	ND
pbpX	pbpX	ND	-6.1	CACAU<left>UUACAAU</left>GAA<right>GUUGUAA</right>CAUUUGUUUUUUUAACA	proposed	14762009 (Cao & Helmann, J. Bacteriol. 2004, 186(4):1136-1146)
spoVS	spoVS	1769462..1769521	-21.7	AUUCU<left>CAACCUGUUUGC</left>GUAAU<right>GCAAACAGGUUG</right>UUUUUCAUUUAUUGU	Northern blotting (0.4 kb transcript)	7559352 (Resnekov et al., J. Bacteriol. 1995, 177(19):5628-5635)
cotE	cotE	1774866..1774928	-16.8	AAAAA<left>GGGACUAGGGG</left>AGACAGUAC<right>CCCCAAGUCUC</right>UUUUUUAUAUUGAUA	proposed	8760914 (Ginetti et al., Microbiology 1996, 142(Pt.8):2021-2029)
mutS,mutL	mutSL	1779499..1779542	-23.4	GGUAG<left>GCAUUGAUCCAUUC</left>UCU<right>GAAUGGAUCAAUGC</right>UUUUUUUGUACUCCU	proposed	8760914 (Ginetti et al., Microbiology 1996, 142(Pt.8):2021-2029)
cwlC	cwlC	1871938..1871986	-13.3	AAAAA<left>CCCGGCUCCUC</left>AUCGC<right>GAGAAACCGGG</right>UUUUUUUAUUCAAGA	upstream and downstream genes are transcribed in the opposite direction	8407798 (Kuroda et al., J. Bacteriol. 1993, 175(19):6260-6268)
spoVK	spoVK	1874362..1874399	-20.0	CUGCA<left>UAGACCUCUCA</left>GUUUU<right>UGAGAGGUCUG</right>UUUUUUGCUCGUAUU	proposed	1787791 (Foulger & Errington, Mol. Microbiol. 1991, 5(6):1363-1373)
glnR,glnA	glnRA	1878958..1879003	-21.1	CUCAA<left>UCCCUUGGCACU</left>AAA<right>AGUGUCAGGGGA</right>UUUUUUAUGUUAAUA	S1 nuclease mapping of the 5' and 3' end of the mRNA	2906311 (Strauch et al., Gene, 71(2):257-65, 1988); 6152242 (Fisher et al., Gene 1984, 32(3):427-438)	A readthrough terminator, or alternatively a transcriptional pause site or RNA processing site, CCGTTTTCA<left>AAGAGGGAATACATTC</left>CGTCAAGGC<right>GACATGTCCCGCTT</right>CTTTCATTAATCCGTTAGCAACTGTTTTGCTATATACATTTTTACCTTTTAAGA was proposed downstream of glnR at 1877551..1877652. The S1 nuclease mapping of the 3' terminus showed that transcription ends in the TTTTTT stretch of the indicated terminator.
ynxB	ynxB	1879734..1879794	-3.2	AAUAA<left>GCCAAU</left>GGGAAA<right>AUUAAGGU</right>UCUUUUUUUAUUUAACA	proposed	2906311 (Strauch et al., Gene 1988, 71(2):257-65)	Strauch et al. propose a different terminator further downstream.
xynP,xynB	xynPB	1889576..1889629	-10.3	UUGCACAUGAAAAA<left>GGAGAUUUCUA</left>UUU<right>UAGAACUCC</right>UUUUUCAUAUGAGAA	proposed; downstream gene is on the opposite strand	(Hastrup, Genetics and Biotechnology of Bacilli, Vol. 2, pp. 79-83, 1988; no PubMed ID)
xylR	xylR	1889670..1889709	-8.4	GACAG<left>CUCAUCU</left>UUAA<right>AGAUGAG</right>UUUUUUUAUUCUAGG	proposed	(Hastrup, Genetics and Biotechnology of Bacilli, Vol. 2, pp. 79-83, 1988; no PubMed ID); SubtiList
xylA,xylB	xylAB	1894390..1894438	-16.5	AAAUA<left>ACCCCUCAC</left>AUUGAC<right>GUGAAGGGGU</right>GUUUUUUAUUGUUACU	proposed	1921970 (Jacob et al., Mol. Gen. Genet. 1991, 229(2):189-196)
cotC	cotC	1904145..1904194	-13.5	UUUCC<left>CCCGGC</left>UAUU<right>GCCGGG</right>UCUUUUUUGUUUGUGCA	proposed	Sonenshein
yndG	yndG	ND	ND	ND	ND	ND
yndN	yndN	1916723..1916782	-20.9	CUAUU<left>CGGGCUCGCACC</left>CAAAAGUCA<right>GGGCGAGCCUG</right>CUUUUUUUGAACAACA	upstream and downstream gene are on the opposite strand	11244082 (Cao et al., J. Bacteriol. 2001, 183(7):2380-2383)
lexA	lexA	1916784..1916826	-19.9	AAUAA<left>CCCCCUCUUCC</left>UUUAC<right>GGAGAGGGGG</right>UUUGUUGUUCAAAAA	upstream and downstream genes are on the opposite strand	1657879 (Raymond-Denise et al., J. Bacteriol. 1991, 173(22):7084-7091)	synonym: dinR
yneA,yneB,ynzC	yneAB-ynzC	1918883..1918937	-17.2	UAUAA<left>GAGGAAUACGG</left>CAAUA<right>UCGUAUUCCUC</right>UUUUGCAUAUACUAU	Northern blotting (1.3 kb transcript)	12581363 (Kawai et al., Mol. Microbiol. 2003, 47(4):1113-1122)
tkt	tkt	1921075..1921117	-13.9	UGAAA<left>GAGGAUGA</left>GUCAAA<right>UCAUCCUC</right>UUUUUCUUGUUUAUC	proposed	9068642 (Schiott et al., J. Bacteriol. 1997, 179(6):1962-1973)
yneE,yneF	yneEF	1922002..1922045	-6.4	AAAAA<left>ACCC</left>UUAUAC<right>GGGU</right>UUUUUAUUUUGCAAU	proposed	9068642 (Schiott et al., J. Bacteriol. 1997, 179(6):1962-1973)	Bidirectional terminator
ynzD	ynzD	1922012..1922057	-4.9	AAAAA<left>CCC</left>GUAUAA<right>GGG</right>UUUUUUAUUUUAUAA	proposed	9068642 (Schiott et al., J. Bacteriol. 1997, 179(6):1962-1973)	bidirectional terminator
ccdA,yneI,yneJ	ccdA-yneIJ	1924160..1924207	-12.2	AAAAA<left>CCUUUCCU</left>CUUGUC<right>AGGAAAGG</right>UUUUUUAUUUGAGAA	Northern blotting (1.8 kb transcript)	9068642 (Schiott et al., J. Bacteriol. 1997, 179(6):1962-1973); 10781554 (Schiott et al., J. Bacteriol. 2000, 182(10):2845-2854)	bidirectional terminator. Internal promoters in front of yneI and yneJ, leading to a 0.9 kb yneIJ transcript and a 0.5 kb yneJ transcript respectively.
yneK	yneK	1924166..1924216	-12.9	AAAAA<left>CCUUUCCU</left>GACAAG<right>AGGAAAGG</right>UUUUUUAAUUCAUUU	proposed; downstream genes are on the opposite strand	9068642 (Schiott et al., J. Bacteriol. 1997, 179(6):1962-1973)	bidirectional terminator
cotM	cotM	1924818..1924897	-15.7	AAAAA<left>GUCACUUUCAU</left>CCCCUAUU<right>AUGAAAGUGAC</right>UUUUUUUCCGUCCAU	downstream gene yneK, unlike cotM, is not induced during sporulation	9068633 (Henriques et al., J. Bacteriol. 1997, 179(6):1887-1897)
sspO,sspP	sspOP	1925308..1925347	-5.9	AAAAG<left>CAGAC</left>CUUAGU<right>GUCUG</right>UUUUUUUAUGCGUUC	lacZ-sspP transcriptional fusion	10806362 (Cabrera-Hernandez, Gene 2000, 248(1-2):169-181)	no transcriptional fusion experiment was performed for the downstream cotM gene
citB	citB	1928618..1928660	-13.6	AGGAA<left>GAGAAGGC</left>AUUUC<right>GCUUUCUC</right>UUCUUUUUAUGACAC	proposed	SubtiList
yneN	yneN	1929166..1929215	-9.4	AAAAA<left>CUGGAUCU</left>UGAUU<right>AGAUUCAG</right>UUUUUUUUAUACUCA	proposed	10333516 (Cabrera-Hernandez et al., Gene 1999, 232(1):1-10)
sspN,tlp	sspN-tlp	1929895..1929936	-11.0	AAAAA<left>CCAGG</left>GAAA<right>CCUGG</right>UUUUUUUCUUUCUGA	lacZ transcriptional fusion to tlp	10333516 (Cabrera-Hernandez et al., Gene 1999, 232(1):1-10)
alsT	alsT	1939533..1939582	-18.4	ACAAA<left>GCUGCAUUCAA</left>UAG<right>UUGAAUGCAGC</right>UUUUUCAUUAUUGGA	Northern blotting (1.5 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); SubtiList
bglC	bglC	1941333..1941378	-14.5	UUUGG<left>CGGACAUC</left>AGUAAC<right>GAUGUCCG</right>UUUUUAUCAUCUAAU	proposed	SubtiList
yngJ,yngI,yngH,yngG,yngF,yngE	yngJIHGFE	1948846..1948889	-15.0	ACUUA<left>GGAGCGC</left>AAAAAAA<right>GCGCUCC</right>UUUAUAUAUUUACAA	proposed	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)
yoxA,dacC	yoxA-dacC	1997507..1997559	-13.3	GGAGA<left>CCUGUUUUC</left>CAAGA<right>GAAAACAGG</right>UUUUUUUAUGUCUGU	lacZ plasmids	9733705 (Pedersen et al., J. Bacteriol. 1998, 180(18):4967-4973)
gltA,gltB	gltAB	2007724..2007772	-12.8	AGAAA<left>CCGGUCUGG</left>CUG<right>CCAGCCGG</right>UUUCUUUUUUUAUUC	Northern blotting (6.1 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
gltC	gltC	2014878..2014937	-18.1	AUGAA<left>CCCGAGCUUCU</left>AUAU<right>AGAAGCUUCGGG</right>UUUUUUUCUGCAAAU	upstream and downstream genes transcribed in the opposite direction	Genbank AF006720
yoxC,yoxB,yoaA	yoxCB-yoaA	2020330..2020371	-12.9	AAAAA<left>GCGCCC</left>CUCAAACA<right>GGGCGC</right>UUUCUAAUUAAGAUG	proposed	10482513 (Petersohn et al., J. Bacteriol. 1999, 181(18):5718-5724)
yoaF	yoaF	2027014..2027064	-24.6	AAUCU<left>GAGGAGAGCGAGAU</left>UCAUU<right>GUCACGCUCUCCUC</right>UGUUUAGCUGUAUGGAU	downstream gene is on the opposite strand	11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457)
yoaG	yoaG	2027009..2027059	-23.4	AAACA<left>GAGGAGAGCGUGA</left>CAAUGAA<right>UCUCGCUCUCCUC</right>AGAUUUGUUUUAUUCACC	downstream gene is on the opposite strand	11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457)
yoaH	yoaH	2028582..2028635	-22.6	CUUAC<left>GUGCAACCCCCAUC</left>UUAUUC<right>GGUGGGGGUUGGC</right>UACUUUUACUGUGGUUGU	Northern blotting (1.6 kb transcript)	15033535 (Serizawa et al., Gene 2004, 329:125-136); Genbank AF027868	Serizawa mentions that the terminator is downstream of yoaH; in the Genbank sequence, the terminator overlaps the gene.
yoaJ	yoaJ	2032099..2032147	-10.6	CGAAA<left>CAGCGG</left>AUCUUUUC<right>CCGCUG</right>UUUUUUCAAUGUUCU	proposed	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629)
yoaN	yoaN	2036694..2036738	-11.1	UAAAU<left>CCCUAUAUA</left>UACGU<right>UAUGUAGGG</right>UUUUUCUGCUUGAAU	Northern blotting (1.2 kb transcript)	14973022 (Costa et al., J. Bacteriol. 2004, 186(5):1462-1474); Genbank AF027868
yoaW	yoaW	2046108..2046158	-15.3	GCCAA<left>GCUAAUGUCU</left>ACAUGC<right>AGACAUUAGC</right>UUUUUUCAUUGUUUA	downstream gene is in the opposite direction	Genbank AF027868
xynA	xynA	2053273..2053326	-9.2	UAAUA<left>GAAUGGUAUUU</left>AAAUGA<right>GAAUGCUAUC</right>AAUUUUUUGUAGUCAGC	Northern blotting (1.0 kb transcript)	8628241 (Allmansberger, Mol. Gen. Genet. 1996, 251(1):108-112)	Genbank Z34519 suggests the terminator TGGAAATTAA<left>GAAAAGAACCTGGTGA</left>AATT<right>TCCCAGGTTCTTTTT</right>ATATTGCAC (dG = -23.6 kcal/mole) at position 2053273..2053326, which does not agree well with the measured mRNA length.
phrK	phrK	2062613..2062651	-15.8	AUUUA<left>GCCCUACUCAA</left>ACAU<right>UUGAGUGGGC</right>UUUUAUUUUAUGAUU	downstream yobH gene is transcribed in the opposite direction	11466295 (McQuade et al., J. Bacteriol. 2001, 183(16):4905-4909)	no terminator identified in Genbank AF027868
yobJ	yobJ	2069346..2069390	-18.7	CUAGG<left>UAGGCCUAUCCCUUCAGGUU</left>CUGA<right>GGCUCAAGGGAGGUCUA</right>UUUUUUCUAUAUACG	proposed	9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371)	Genbank AF027868 does not list a terminator
yobO	yobO	ND	ND	ND	downstream genes are on the opposite strand	ND
yobW	yobW	ND	ND	ND	upstream and downstream genes are in the opposite direction	8990290 (Henriques et al., J. Bacteriol. 1997, 179(2):389-398)
des	des	2089656..2089709	-18.9	AUAAA<left>GGAGGUCUUCUA</left>AUAUAC<right>UAGAAGGCUUCC</right>UUUUUAUUGUUGGAG	Northern blotting (1.1 kb transcript)	10559169 (Aguilar et al., J. Bacteriol. 1999, 181(22):7028-7-33)
yocF,yocG	yocFG	2091498..2091551	-19.7	AAAAA<left>GGAUCUUGGC</left>AUCU<right>GCCAGGAUCC</right>UUUUUGUUAACCUGA	Northern blotting (1.9 kb)	11285232 (Aguilar et al., EMBO J. 2001, 20(7):1681-1691); Genbank AF027868	synonym: desKR
bsrB	bsrB	2095108..2095154	-16.3	CGAAA<left>GCCAUUUCC</left>UUUUC<right>GGAAAUGGC</right>UUUUUAUUUUAUCUA	Northern blotting	11886746 (Ando et al., FEMS Microbiol. Lett. 2002, 207(1):29-33)	RNA gene
yocK	yocK	2096292..2096337	-13.2	GCCAA<left>GCAAGUACA</left>CCGAUAUUAGA<right>UGUACUUGC</right>UUUUUUUUGAAAAAA	Northern blotting (0.5 kb transcript)	10220166 (Petersohn et al., Microbiology 1999, 145(Pt.4):869-880); Genbank AF027868
yozO	yozO	2098572..2098615	-14.1	UGAUG<left>AGCCAGCCGUU</left>CAAAA<right>AAUGGUUAGGCU</right>UUUUUUAUAUAUAAA	downstream gene is on the opposite strand	11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457)
odhA,odhB	odhAB	2106674..2106727	-21.3	AAAAA<left>GGGUACAUCAC</left>GAUAAA<right>GUGAUGUACCC</right>UUUUUGAUGCAUAUU	Northern blotting (4.3 kb transcript)	11976317 (Condon et al., J. Bacteriol. 2002, 184(10):2845-2849); Genbank M27141
yodF	yodF	2131052..2131102	-18.4	AAAAA<left>CCAUACGCGG</left>CAG<right>CCGCGUAUGG</right>UUUUUUUUACAUUUC	Northern blotting (1.8 kb transcript); upstream and downstream genes are on the opposite strand	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
cgeC,cgeD,cgeE	cgeCDE	2144968..2145012	-18.8	AAAUUUCAAAA<left>GAGCCUUCCU</left>UAUU<right>AGGAAGGCUC</right>UUUUUAUGUGAAAAA	Northern blotting (2.7 kb transcript)	7592393 (Roels & Losick, J. Bacteriol. 1995, 177(21):6263-6275); SubtiList	potential readthrough terminator is located downstream of cgeC, leading to a 0.4 kb monocistronic cgeC transcript.
cgeA,cgeB	cgeAB	2149215..2149269	-10.6	AAAAA<left>UCGUUCAU</left>UGCU<right>AUGAACGA</right>UUUUUUUAUUCAUAG	Northern blotting (1.4 kb transcript)	7592393 (Roels & Losick, J. Bacteriol. 1995, 177(21):6263-6275)	A shorter 1.0 kb transcript was also detected, which may be due to a terminator inside the cgeB coding region, or a processing or degradation product of the 1.4 kb transcript.
phy	phy	2149271..2149317	-10.3	AGAAA<left>GCAGCU</left>UGUGC<right>AGCUGC</right>UUUUUUCUAUGAAUA	proposed	7592393 (Roels & Losick, J. Bacteriol. 1995, 177(21):6263-6275)
yotK	yotK	ND	ND	ND	ND	ND
sspC	sspC	2155646..2155688	-14.7	UUUAU<left>GAGGGGGA</left>UAA<right>UUCCCCUC</right>UCUUUUUUAAGUCUUCU	Northern blotting (0.29 kb transcript)	2981806 (Connors & Setlow, J. Bacteriol. 1985, 161(1):333-339)
ypqP	ypqP	2286244..2286301	-17.0	AAAAA<left>CAAGCCUGUCUA</left>UCCAU<right>UAGGCAGGCCUG</right>UUUUUAACAGUUUAU	proposed; downstream genes are on the opposite strand	Genbank L77246	bidirectional terminator
yppQ	yppQ	2286246..2286302	-16.0	AAAAA<left>CAGGCCUGCCUA</left>AUGGA<right>UAGACAGGCUUG</right>UUUUUAUGCCUUUUU	proposed; downstream genes are on the opposite strand	Genbank L77246	bidirectional terminator
ypoP	ypoP	2287798..2287851	-16.4	AAAAA<left>GCACAUACC</left>GAUAUAUA<right>GGUAUGUGC</right>UUUUCGCAGUGCUUC	proposed; upstream and downstream genes are on the opposite strand	Genbank L77246	bidirectional terminator
ypnP	ypnP	2287816..2287858	-15.7	GAAAA<left>GCACAUACC</left>UAUAUAUC<right>GGUAUGUGC</right>UUUUUUUCACCGUUU	proposed; downstream gene is on the opposite strand	Genbank L77246	bidirectional terminator
ypmT	ypmT	2289240..2289284	-7.2	AAAAA<left>GAGAC</left>AUGAAACAAC<right>GUCUC</right>UUUUUUCGUGUGGUC	proposed	Genbank L77246
ilvA,ypmP	ilvA-ypmP	2291545..2291624	-30.8	UUUUA<left>CCUGCAUGCCCUCCUUUGUAA</left>UCG<right>UUAAUGGGGAGGCAUGCAGG</right>AUUUUUUUUGCUCAGU	Northern blotting (1.6 kb transcript)	15060025 (Mader et al., J. Bacteriol. 2004, 186(8):2240-2252)	internal promoter in front of ypmP, leading to a 0.25 kb transcript.
yplQ	yplQ	2295137..2295181	-16.8	GAAAA<left>GCGCAGUC</left>UUCAC<right>GACUGCGC</right>UUUUUUAUGCACGUA	proposed; downstream genes are on the opposite strand	Genbank L77246	bidirectional terminator
ypkP	ypkP	2295139..2295198	-17.5	AAAAA<left>GCGCAGUC</left>GUGAA<right>GACUGCGC</right>UUUUCUGUUACUGUU	proposed; downstream genes are on the opposite strand	Genbank L77246	bidirectional terminator
ypjQ	ypjQ	2297138..2297186	-12.3	AAAAA<left>UCAUUUCUG</left>GGUU<right>CAGAAAUGA</right>UUUUUUAUUGUGUUA	proposed	Genbank L77246
ypiP	ypiP	2298580..2298613	-17.0	AACAA<left>GCCCGUGAU</left>UCAU<right>AUCACGGGC</right>UUUCUGUUAAUCGGU	proposed	Genbank L77246
yphP	yphP	2299390..2299425	-11.8	CUAAA<left>UGCCCG</left>UUCUC<right>CGGGCA</right>UUUUCUUUUUGGGAG	proposed	Genbank L77246
ilvD	ilvD	2299844..2299912	-31.9	GUGAACAUUUGAAAUCCG<left>GCCCUCUCUAUAGUAUCCUUUA</left>CUUCAGA<right>UGAAGGAUACUAGAGGGGGC</right>UUUUUUUAUGUCAAU	Northern blotting (1.8 kb transcript)	15060025 (Mader et al., J. Bacteriol. 2004, 186(8):2240-2252); SubtiList
ypgR	ypgR	2301886..2301941	-11.4	AAAAA<left>GGUGCA</left>GAUCA<right>UGCACC</right>UUUUUUAUGUGAAUU	proposed	Genbank L77246
metA	metA	2305453..2305490	-12.9	AGCCA<left>GUGAAUCGCU</left>GGAA<right>AGCGCAUGCCAC</right>AUUAUUGUUUAUGAAU	proposed	Genbank L77246	The Genbank record shows CCAAGAAAC<left>TCCT</left>TATGA<right>ATGG</right>GACTAATTTTTCTTTT (dG = -5.0 kcal/mole) as the proposed terminator. An open reading frame can be found in front of this second terminator.
degR	degR	2307326..2307367	-19.3	CAAAU<left>AGGAGAGGC</left>GAAU<right>GCCUCUCCU</right>CUAUUUGUCAUCUCAUCA	upstream and downstream genes are in the opposite direction	3082853 (Nagami & Tanaka, J. Bacteriol. 1986, 166(1):20-28)
ypeQ	ypeQ	2307953..2308008	-10.0	AAAAA<left>CCGCAG</left>AAG<right>CUGCGG</right>UUUUUAUUCUUUGAA	proposed; downstream gene is on the opposite strand	Genbank L77246
sspL	sspL	ND	ND	ND	downstream gene is transcribed in the opposite direction	10333516 (Cabrera-Hernandez et al., Gene 1999, 232(1):1-10)
ypcP	ypcP	2310160..2310216	-22.1	CUGAA<left>CGCUAGAGAGAUC</left>GUUUA<right>GAUCCUCUCUAGCG</right>UUUUGUAUUGCUUUU	proposed; downstream genes are on the opposite strand	ND	Genbank L77246 proposes the terminator CGGAGTAACACC<left>GCCGG</left>TCAG<right>CCGGC</right>CTTTATCTTTCTT (dG = -10.0 kcal/mole) further downstream at position 2310062..2310100 instead. The indicated terminator was found by mfold.
ypbS	ypbS	2311136..2311179	-15.4	UCAAA<left>CAGUAUCUCU</left>AAUUAA<right>AGAGAUACUG</right>UUUUUUAUUUUUGGG	proposed	Genbank L77246
xpt,pbuX	xpt-pbuX	2317300..2317339	-11.0	UCUAA<left>CUCCGC</left>CGCG<right>GCGGAG</right>UUUUUUUUGCAUAUA	Northern blotting (2.1 kb transcript)	9098051 (Christiansen et al., J. Bacteriol. 1997, 179(8):2540-2550)
ypwA	ypwA	ND	ND	ND	proposed	ND	The terminator proposed in Genbank L77246 was not found using mfold.
kdgR,kdgK,kdgA,kdgT	kdgRKAT	ND	-15.5	AAAAA<left>GGCUGCC</left>ACAAAACAUACC<right>GGCAGCC</right>UUUUAUACAAACAAU	Northern blotting (3.7 kb transcript)	9846747 (Pujic et al., Microbiology 1998, 144(Pt.11):3111-3118)
ypvA	ypvA	2326646..2326693	-14.4	AAAAA<left>GCUGACGA</left>UCGU<right>UCGUCAGC</right>UUUUUUAUUUGUCAG	proposed	Genbank L47838	This gene is referred to as ypuA in the Genbank file
cotD	cotD	2331908..2331946	-14.9	ACAAA<left>UGGGGCCC</left>ACG<right>GGAGCCCCA</right>UUUUUUAAAGCAGGU	experimental	Genbank L47383	Genbank L47838 lists experimental evidence for this terminator, but does not specify the evidence further.
sspM	sspM	2338954..2339004	-17.1	CGUAA<left>GAAGCAAGGA</left>AUU<right>UCCUUGCUUC</right>UUUAUUUUUUCAGCC	upstream and downstream genes are transcribed in the opposite direction	10806362 (Cabrera-Hernandez, Gene 2000, 248(1-2):169-181)
recU,ponA	recU-ponA	2343370..2343425	-18.6	AAAAA<left>GCCGUCACCU</left>UUG<right>GGGUGAUGGC</right>UUUUUUGGUACACAA	lacZ transcriptional fusions	7814321 (Popham & Setlow, J. Bacteriol 1995, 177(2):326-335); Genbank L47838
ypjB	ypjB	2360704..2360754	-14.7	UGAGG<left>GGCGGC</left>GGUCA<right>GCCGCC</right>UUUUUUCUAUUACAU	downstream gene in in the opposite direction	8760912 (Sorokin et al., Microbiology 1996, 1442(Pt.8):2005-2016)	Genbank L47709
qcrA,qcrB,qcrC	qcrABC	2362220..2362272	-10.3	CAAAA<left>GCUGAC</left>CCGGC<right>GUCAGC</right>UUUUUUAUAUGGACA	Northern blotting (2.0 kb transcript)	7592464 (Yu et al., J. Bacteriol. 1995, 177(23):6751-6760)
trpE,trpD,trpC,trpF,trpB,trpA,hisC,tyrA,aroE	trpEDCFBA-hisC-tyrA-aroE	2367127..2367179	-14.6	AAAAA<left>UCCUGAAGU</left>UUU<right>ACUUCAGGA</right>UUUUUUAUGCAGAUC	integrative plasmids to interrupt transcription	3106153 (Henner et al., Gene 1986, 49(1):147-152); 3924737 (Henner et al., Gene 1985, 34(2-3):169-177); 11566976 (Babitzke & Gollnick, J. Bacteriol. 2001, 183(20):5795-5802)	transcription starting from the promoter in front of aroF leads to an aroFBH-trpEDCFVA-hisC-tyrA-aroE transcript and an aroFBH transcript, terminating at the terminator-antiterminator structure in front of trpE. An internal promoter may exist upstream of hisC.
mtrA,mtrB	mtrAB	2383662..2383696	-3.9	CAAACAGC<left>GGGAGG</left>AUACAG<right>CCAAUUCU</right>UUUUUUUAUGCUAUAA	plasmid-mediated homologous integration of overlapping DNA fragments of the mtr region	2123343 (Gollnick et al., Proc. Natl Acad. Sci. USA 1990, 87(22):8726-8730)
hbs	hbs	2384655..2384717	-13.0	GAAAA<left>GCCCCUU</left>UCU<right>AAGGGGC</right>UUUUCAUAUUUCAAG	Northern blotting (0.38 kb and 0.54 kb transcripts)	1902464 (Micka et al., J. Bacteriol. 1991, 173(10):3191-3198)
spoIVA	spoIVA	2385351..2385386	-12.2	CGGUA<left>GACCUCUU</left>UAUAGAAU<right>GGGAGGUC</right>UUUUUUCUUUGCUCU	Northern blotting (1.6 kb transcript)	1729246 (Roels et al., J. Bacteriol. 1992, 174(2):575-585); 1729247 (Stevens et al., J. Bacteriol. 1992, 174(2):586-594)	mfold found a stronger stem-loop TGTTACTCTACATAC<left>AGAAATTCTTCACTTTGTTGGA</left>CAAACAT<right>TCCTCAGAGTGCAGTTTTTCT</right>TAAAAAGCCGTTTAATTGTCTTTCTCTTACTTGCT with dG = -16.4 kcal/mole at position 2385115..2385214 further downstream. There may be another gene between spoIVA and this stem-loop.
sleB,ypeB	sleB-ypeB	2396924..2396974	-4.8	GGAAA<left>GGAC</left>UAAAU<right>GUCU</right>UUUCCUUUUUUUCAU	Northern blotting (2.2 kb transcript)	10197998 (Moriyama, J. Bacteriol. 1999, 181(8):2373-2378); 8760912 (Sorokin et al., Microbiology 1996, 142(Pt.8):2005-2016)
serA	serA	2411846..2411896	-12.6	AAAAA<left>CUCAAGCU</left>AUAU<right>AGCUUGAG</right>UUUUUUUAUUGUUCU	Northern blotting (1.6 kb transcript); upstream and downstream genes are on the opposite strand	7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); Genbank L47648	bidirectional terminator
aroC	aroC	2411856..2411923	-12.6	AAAAA<left>CUCAAGCU</left>AUAU<right>AGCUUGAG</right>UUUUUUUAAUUAUGG	Northern blotting (0.9 kb transcript); downstream gene is on the opposite strand	7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); Genbank L09228	bidirectional terminator
sigX,rsiX	sigX-rsiX	2412750..2412811	-8.6	AAAAA<left>GAGCC</left>CUUUAA<right>GGCUC</right>UUUUUUAGUUGCUAU	Northern blotting (1.8 kb transcript)	7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); Genbank L09228
resA,resB,resC,resD,resE	resABCDE	2414539..2414582	-16.9	AGAAA<left>CACCCGCU</left>GACUG<right>AGCGGGUG</right>UUUUUUUAAUAGCCA	Northern blotting	8631715 (Sun et al., J. Bacteriol. 1996, 178(5):1374-1385); 7934829 (Sorokin et al., Mol. Microbiol. 1993, 10(2):385-395); 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405)	Internal promoter in front of resD, leading to a 2.5 kb transcript. Azevedo found a 7.0 kb transcript that started upstream of ypuL (in front of resA), as well as a shorter 0.7 kb transcript corresponding to ypuL only. The transcripts detected by Azevedo and Sun both had a length of 7 kb, which is 1 kb longer than needed for a resABCDE operon. In addition, Azevedo found that a probe for ypuL hybridizes to the 7 kb transcript, indicating that the transcript corresponds to ypuL-resABCDE. Such a transcript agrees well with the length of 7 kb measured by Northern blotting. However, Sun's primer extension experiment showed a single promoter just in front of resA.
dacB,spmA,spmB	dacB-spmAB	2421439..2421495	-8.3	GUUAC<left>GUUAUUAUUUGGG</left>AGCG<right>CCUGAAAACGGC</right>GUUUUUUUUAGAUUUG	lacZ transcriptional fusions	7642500 (Popham et al., J. Bacteriol. 1995, 177(16):4721-4729); 7934829 (Sorokin et al., Mol. Microbiol. 1993, 10(2):385-395); SubtiList	Sorokin et al. propose the alternative terminator T<left>GAAAAC</left>GGC<right>GTTTTT</right>TTTAGAT (dG = -0.3 kcal/mole) at position 2421435..2421457).
ypuG,ypuH,ypuI	ypuGHI	2423809..2423847	-14.7	GUUUA<left>CUCUCCCU</left>UUUUC<right>AGGGAGAG</right>UUUUUUUAUGUUUGC	Northern blotting (2.0 kb transcript)	7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); 1548223 (Buchanan & Ling, J. Bacteriol. 1992, 174(6):1717-1725)	Internal promoter in front of ypuI, leading to a 0.5 kb transcript.
ypuF	ypuF	2426546..2426604	-16.6	AAAAA<left>AAGCAGAGACUG</left>AUCA<right>CAGCCUCUGCUU</right>AAUUAUUGUAUGAAAUG	proposed	Genbank L09228	bidirectional terminator
ypuE,ribD,ribE,ribA,ribH,ribT	ypuE-ribDEAHT	2426567..2426618	-17.0	AUUAA<left>GCAGAGGCUG</left>UGAU<right>CAGUCUCUGC</right>UUUUUUUUCUGCGUU	Northern blotting (4.3 kb transcript); nuclease protection mapping of the 5' end	8159171 (Mironov et al., Mol. Gen. Genet. 1994, 242(2):201-208); 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); (Perkins et al., J. Ind. Microbiol. Biotechnol. 1999, 22(1):8-18; no PubMed ID); 2112225 (Mironov et al., Mol. Biol. (Mosk.) 1990, 24(1):221-225; Molekulyarnaya Biologiya 1990, 24(1):256-261); Genbank L09228	Bidirectional terminator. Internal promoters in front of ribA and ribT, leading to a 2.4 kb and a 0.4 kb transcript. The original papers do not mention the existence of the ypuE gene, which partly overlaps ribD. The promoter site that was found experimentally for ribD lies upstream of ypuE. Just upstream of ribD is a putative terminator/antiterminator structure. Azevedo also finds a 0.16 kb ypuE-specific transcript.
ypuD	ypuD	2430890..2430941	-19.4	AAAAA<left>CAUCACCUUUCG</left>GAU<right>CGAAGGGUGAUG</right>UUUUGUUUUUCUCAA	Northern blotting (0.6 kb transcript)	7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); Genbank L09228
sipS	sipS	2431473..2431529	-13.1	AUCAA<left>GCAGCUUC</left>CCAUU<right>GGGGCUGC</right>UUUUUUUAUAUCUUU	Northern blotting (1.2 kb and 0.45 kb)	7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); 8951809 (Bolhuis et al., Mol. Microbiol. 1996, 22(4):605-618); Genbank L09228	Azevedo found two transcripts, which correspond to the two transcription start sites found by Bolhuis.
ypuB,ypuC	ypuBC	2432900..2432942	-16.5	CG<left>AGUGAUGUUGCUGCGGGU</left>UAC<right>GCCUUCGGCGGUGUUUGGCU</right>GAGUUUGAAUGUUUUGGU	proposed	10482513 (Petersohn et al., J. Bacteriol. 1999, 181(18):5718-5724); 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405)	In a Northern blotting experiment, Azevedo found a 1.2 kb transcript covering ypuB and ypuC, but starting far upstream of ypuB.
ppiB	ppiB	2434508..2434556	-15.7	AAAAG<left>GCUUCCUCU</left>UAG<right>AGAGGAAGC</right>UUUUUUUAUUGGCCA	Northern blotting (0.5 kb transcript); upstream and downstream gene are on the opposite strand	8022278 (Herrler et al., Mol. Microbiol. 1994, 11(6):1073-1083); 7934829 (Sorokin et al., Mol. Microbiol. 1993, 10(2):385-395); 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405)
ypuA	ypuA	2436090..2436143	-10.7	AAAAG<left>CGCCGA</left>AAAA<right>UCGGCG</right>UUUCUUUUAUUGCUU	Northern blotting (0.8 kb transcript); upstream and downstream genes are on the opposite strand	7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); Genbank L09228	bidirectional terminator
spoVAA,spoVAB,spoVAC,spoVAD,spoVAE,spoVAF,lysA	spoVAABCDEF-lysA	2436105..2436149	-11.5	AGAAA<left>CGCCGA</left>UUUU<right>UCGGCG</right>CUUUUCUUAUUUGAAU	integrational plasmids; Northern blotting; downstream gene is in the opposite direction	3926949 (Fort & Errington, J. Gen. Microbiol. 1985, 131(Pt.5):1091-1105); 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); BSORF, Genbank L09228	The integrational plasmids showed that at least spoVAA through spoVAE belong to the same operon. The coding regions of spoVAE and spoVAF overlap. No terminator was found between spoVAF and lysA (Genbank L09228). Azevedo et al. found a 2.3 kb transcript orginating about 1 kb upstream of the lysA start codon, suggesting that transcription of spoVA continues into the lysA gene. However, the BSORF database contains a transcript consisting of the spoVA genes only. The lysA gene is also transcribed monocistronically as a 1.3 kb transcript.
dacF,spoIIAA,spoIIAB,sigF	dacF-spoIIAAB-sigF	2442592..2442641	-17.1	GGAUG<left>GCUAGUCUGC</left>AGU<right>GCAGGCUAGC</right>UUUUUUGUGCAAAAG	Northern blotting (2.9 kb transcript)	2492512 (Wu et al., J. Bacteriol. 1989, 171(2):692-698); 1629150 (Wu et al., J. Bacteriol. 1992, 174(15):4885-4892); BSORF	Internal promoter in front of spoIIAA, leading to a 1.7 kb transcript.
drm,punA	drm-punA	2445546..2445598	-20.2	CAAAA<left>GACAGCUGUGU</left>CUGAUAUC<right>ACACAGCUGUC</right>UUUUUUUAUGCCCAA	Northern blotting (2.1 kb transcript); transcriptional fusions	10537218 (Schuch et al., Microbiology 1999, 145(Pt.10):2957-2966)	Northern blotting results in BSORF show a drm-punA, a ripX-drm-punA, and a fur-ripX-drm-punA transcript. Wu et al. (1629150) consider a monocistronic punA transcript.
fur	fur	2448982..2449026	-11.7	GCGAA<left>CCUUUUCUC</left>AUG<right>GGGAAAGGG</right>UUUUUUGCUGUUUCU	proposed	12029044 (Fuangthong et al., J. Bacteriol. 2002, 184(12):3276-3286); SubtiList	Northern blotting results in BSORF show a fur-ripX-drm-punA transcript and a monocistronic fur transcript.
spoIIM	spoIIM	ND	ND	ND	Northern blotting	8501065 (Smith & Youngman, J. Bacteriol. 1993, 175(11):3618-3627); BSORF
ansA,ansB	ansAB	ND	ND	ND	5' primer extension analysis of ansB	1711029 (Sun & Setlow, J. Bacteriol. 173(12), 3831-3845, 1991)	Northern blotting results in BSORF show an ansAB, an ansAB-yqkIJK, a nudF-yqxK-ansAB, and a nudF-yqxK-ansAB-yqkIJK transcript. The stem-loop UUGUAUAAAAU<left>ACAGCUUAUUCAUCUCCGA</left>AUAG<right>UCGGAUGAAUAAGCUGU</right>UUA at position 2453478..2453531, suggested by Sun & Setlow, is missing a T-stretch.
ansR	ansR	2456662..2456707	-5.4	GAACA<left>GCCAUUUC</left>UGUUCC<right>GAAGGC</right>UUUUUUUAGUUUGUC	Northern blotting; upstream and downstream genes are on the opposite strand	8478318 (Sun & Setlow, J. Bacteriol. 1993, 175(9):2501-2506); BSORF	Northern blotting results in BSORF suggest that ansR is transcribed in the opposite direction as part of the nudF-yqxK-ansAB and the nudF-yqxK-ansAB-yqkIJK transcripts. Sun et al. propose the terminator AC<left>AGGAGGAACTGAGTTAATCTTTAGCTCACGGT</left>TTAATTTT<right>ACCGTAGGTTCCTCCT</right>C in this region; however, this secondary structure is not recognized by mfold and lacks a T-stretch.
yqkF	yqkF	2459429..2459476	-18.8	AAAAA<left>CCAGCACCU</left>GUAC<right>GGGUGCUGG</right>UUUAUUUAUAUUGAU	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF
yqkE	yqkE	2459163..2459217	-16.2	AUAAA<left>CCAGCACC</left>CGUACA<right>GGUGCUGG</right>UUUUUCUGCUAUGAG	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF
yqkD	yqkD	2460762..2460811	-7.6	CGAAA<left>GGCC</left>UCUUC<right>GGCU</right>CUUUCGCUUUUUUAUG	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF; SubtiList
yqjY,yqjZ,yqkA,yqkB,yqkC	yqjYZ-yqkABC	2460766..2460817	-17.9	AAAAA<left>GCGAAAGAGCC</left>GAAGA<right>GGCCUUUCGC</right>UUUUUUAUUCUGUUG	Northern blotting	BSORF	Northern blotting results in BSORF suggest the existence of internal promoters in front of yqkB and yqkC
yqzH	yqzH	ND	ND	ND	Northern blotting	BSORF
yqjV,yqjU	yqjVU	ND	ND	ND	Northern blotting	BSORF
yqjP,yqjQ,dsdA,coaA,yqjT	yqjPQ-dsdA-coaA-yqjT	2467141..2467179	-14.4	GUUUG<left>CGGGAGAGA</left>UUCAU<right>UCUCUUCCG</right>UUUUUUAUUUAAAGC	Northern blotting	BSORF	Northern blotting results in BSORF suggest the existence of an internal promoter in front of coaA
proI	proI	2473180..2473221	-15.7	AAAAA<left>CAGAAGGCA</left>CAG<right>UGCCUUCUG</right>UUUUUUAUUUUUCCC	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF; SubtiList
yqjN	yqjN	2473185..2473233	-15.7	AAAAA<left>CAGAAGGCA</left>CUG<right>UGCCUUCUG</right>UUUUUGUCCUUACAU	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF
yqjM	yqjM	2476045..2476088	-15.9	CAUAA<left>GAGAUAUCCU</left>GUAG<right>AGGAUAUCUC</right>UUUUUUUAUUUUUAG	Northern blotting	BSORF; SubtiList
yqjL	yqjL	2476935..2476969	-8.7	AGACC<left>GGGCCGUAAGG</left>GAUU<right>CCCGGUCU</right>UUUAUAUUAUUUUGU	Northern blotting; downstream gene is on the opposite strand	BSORF
yqjK	yqjK	2476799..2476847	-14.3	UAAAA<left>GACCGGGAAUCC</left>CUUAC<right>GGCCCGGUC</right>UUUUUUUACGUUAAU	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF
zwf	zwf	2479803..2479861	-17.8	AAAAA<left>GCCGAAAAUGU</left>UUACAA<right>GCAUUUUCGGC</right>UUUUUUACGCUGAAC	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF; SubtiList
yqjH,yqjI	yqjHI	2479892..2479942	-21.0	AGAAA<left>CCCCCGAAGCU</left>CUUA<right>AGCUUUGGGGG</right>UUUUGUUAUUAAGGA	Northern blotting	BSORF; SubtiList	Northern blotting results in BSORF suggest the existence of an internal promoter in front of yqjI
yqjG	yqjG	2483903..2483958	-18.7	AAAAG<left>CAACCCCGUGC</left>AAAAA<right>GCCGGGGUUG</right>UUUUUUGUUACUUGC	Northern blotting	BSORF; SubtiList
yqiW	yqiW	2492210..2492265	-15.4	AACAA<left>CCCGGAUGCU</left>CAA<right>AGCAGCCCGGG</right>UUUUUUUGUGCAUAA	Northern blotting	BSORF; SubtiList
bmrU,bmr,bmrR	bmrU-bmr-bmrR	2495931..2495984	-19.9	AAAAA<left>GAGCAUUUUUUGAA</left>ACAAAAC<right>UUCAAAAAAUGCUC</right>UUUUUGCUUAUUUAG	Northern blotting (3.8 kb transcript)	10220166 (Petersohn et al., Microbiology 1999, 145(Pt.4):869-880); 7961792 (Ahmed et al., J. Biol. Chem. 1994, 269(15):28506-28513); BSORF	Bidirectional terminator. Readthrough terminator downstream of bmrU leads to a 1.0 kb transcript. Readthrough terminator CAGCAC<left>GTGATAAGAAGCGCATTCTTTGT</left>GTACT<right>GCAAAGAATGCGCTTCTTCTTTAT</right>ACTGATGATAG with dG = -29.1 kcal/mole at position 2495007..2495075 leads to a 2.5 kb transcript. Internal promoter in front of bmr.
ptb,bcd,buk,lpdV,bkdAA,bkdAB,bkdB	ptb-bcd-buk-lpdV-bkdAABB	2495924..2495981	-27.3	C<left>AAAAAGAGCAUUUUUUGAAG</left>UUUUG<right>UUUCAAAAAAUGCUCUUUUU</right>CUAUGCUUUAUU	Northern blotting (7.9 kb transcript)	15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107); 8504804 (Wang et al., Eur. J. Biochem. 1993, 213(3):1091-1099)	Bidirectional terminator. Northern blotting results in BSORF show various transcripts in this region. Northern blotting experiments by Yoshida (12823818) show a 8.7 kb bkdR-ptb-bcd-buk-lpdV-bkdAA-bkdAB transcript. Nickel also found a 10.2 kb bkdR-ptb-bcd-buk-lpdV-bkdAA-bkdAB-bkdB transcript due to readthrough at the terminator downstream of bkdR.
bkdR	bkdR	ND	ND	ND	Northern blotting (2.1 kb transcript)	15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107)	Nickel also found a 10.2 kb bkdR-ptb-bcd-buk-lpdV-bkdAA-bkdAB-bkdB readthrough transcript. Northern blotting experiments by Yoshida (12823818) show a 8.7 kb bkdR-ptb-bcd-buk-lpdV-bkdAA-bkdAB transcript.
yqzF	yqzF	2506437..2506486	-14.9	AAAAA<left>GCCGGAG</left>AAUG<right>CUCCGGC</right>UUUUUUUGUUGCAUU	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF
mmgA,mmgB,mmgC,mmgD,mmgE,yqiQ	mmgABCDE-yqiQ	2506452..2506498	-13.4	AAAAA<left>GCCGGAG</left>CAUU<right>CUCCGGC</right>UUUUUUUCAGCUAUC	lacZ transcriptional fusion; Northern blotting	8759838 (Bryan et al., J. Bacteriol. 1996, 178(16):4778-4786); BSORF; SubtiList	The transcriptional fusion shows that the operon includes mmgE, but does not exclude the possibility that genes further downstream are also included. Eichenberger (12662922) also includes the downstream yqiQ as part of the operon. The Northern blotting results in BSORF show a mmgABCDE-yqiQ transcript.
yqiG	yqiG	2516729..2516784	-18.9	GCAAA<left>GACUGCCGAA</left>ACGA<right>UUCGGCAGUC</right>UUUUUUCCCUUUAUA	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF; SubtiList
spo0A	spo0A	2517157..2517253	-21.1	GUCAUUAAAUCAAA<left>CGUCUUUUAUUUAUUAGU</left>UUGC<right>GCUGAUAAAUAGGAGGCG</right>UUUUGUUUUGGGGAC	S1 nuclease mapping; Northern blotting	3157992 (Ferrari et al., Proc. Natl Acad. Sci. USA 1985, 82(9):2647-2651); BSORF	The S1 nuclease mapping experiment showed that transcription terminates at the seventh nucleotide in the T-stretch UUUUGUUUUGGGG.
spoIVB	spoIVB	2518305..2518360	-16.0	GCUGA<left>CUGCCGGA</left>GUU<right>UCCGGCAG</right>UUUUUUUAUUUUGAU	Northern blotting	2106508 (Van Hoy & Hoch, J. Bacteriol. 1990, 172(3):1306-1311); BSORF
ahrC,recN	ahrC-recN	2519759..2519804	-16.2	GGUAA<left>GCUGCGC</left>GAGAA<right>GCGCAGC</right>UUAUUUUUUUCGUGC	proposed	2106508 (Van Hoy & Hoch, J. Bacteriol. 1990, 172(3):1306-1311)	Northern blotting results in BSORF show an ahrC-recN transcript, a yqiBCDE-yqxC-ahrC-recN transcript, and a yqiE-yqxC-ahrC-recN transcript.
yqxC	yqxC	2522079..2522118	-12.2	GUACC<left>GGAAUAAUAG</left>GGCG<right>CUAUUAUUCC</right>UUUUUUCUGCAUUCA	proposed	2507400 (North et al., Gene 1989, 80(1):29-38)
nusB,folD	nusB-folD	2527534..2527575	-9.0	ACCCG<left>CUUCUUCAGGCU</left>CCUAA<right>AGCCAGGGCGGG</right>UUUUCUUUAGUUAUG	proposed	11591660 (Saxild et al., J. Bacteriol. 2001, 183(21):6175-6183)	Northern blotting results in BSORF show various transcripts in this region.
accB,accC,yqhY	accBC-yqhY	2529111..2529154	-4.0	CCAAG<left>GGG</left>AGGGCGG<right>CCC</right>UUUGGUUUUUUUACA	Northern blotting (2.9 kb transcript)	7592499 (Marini et al., J. Bacteriol. 1995, 177(23):7003-7006); BSORF	Northern blotting results in BSORF also show a accBC-yqhY-nusB-folD readthrough transcript.
yqhV,spoIIIAA,spoIIIAB,spoIIIAC,spoIIIAD,spoIIIAE,spoIIIAF,spoIIIAG,spoIIIAH	yqhV-spoIIIAABCDEFGH	2531540..2531581	-15.5	AAAAA<left>GCCCGCU</left>AAACA<right>AGCGGGC</right>UUUUUGCGUUGCUGU	transcriptional fusions & Northern blotting (5.9 kb transcript)	1766372 (Illing & Errington, Mol. Microbiol. 1991, 5(8):1927-1940); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); Genbank U35252	Transcriptional fusions showed that spoIIIA contains at least the A, B, and C genes. Northern blotting revealed a yqhV-spoIIIAABCDEFGH transcript. The promoter in front of spoIIIAA may therefore be an internal promoter. BSORF lists a spoIIIAABCDEFGH transcript, in addition to shorter spoIIIAGH and spoIIIAH transcripts. Internal promoter in front of spoIIIAG, overlapping spoIIIAF.
yqhQ,yqhP	yqhQP	ND	-11.3	UUUAC<left>CUAGCUC</left>AAUCA<right>GGGCUAG</right>UUUUUUUUGUUGUGUU	proposed	10482513 (Petersohn et al., J. Bacteriol. 1999, 181(18):5718-5724)
gcvT,gcvPA,gcvPB	gcvT-gcvPA-gcvPB	2544602..2544641	-15.7	AAAAA<left>CAGCUGUCU</left>ACC<right>AGACAGCUG</right>UUUGCUUUAUUUCUU	Northern blotting (4.2 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)	A potential readthrough terminator was found downstream of gcvPA (2.5 kb transcript). An internal promoter may exist upstream of gcvPA (2.8 kb transcript).
sinI,sinR	sinIR	2552235..2552304	-25.3	AAAAA<left>GAGGAGUAGUGCCU</left>GAGCAG<right>AGGCACUAACUCCUC</right>UUUUGUCAAUAACCA	S1 mapping of the 3' end	3125149 (Gaur et al., J. Bacteriol. 1988, 170(3):1046-1053)	a second terminator structure CCAUC<left>GAGACGGCCCAGUAU</left>AUGA<right>AUACUGGGCCGUCUC</right>UUUUUUUUGCUGUUA with dG = -31.2 kcal/mole was found at 2552207..2552261; transcription ended at one of these two terminators. Termination sites are the first and last T in the T-stretch TCTTTTGT of the first terminator, and the first T in the T-stretch TCTCTTTTTTT of the second terminator. Internal promoter in front of sinR.
yqxM,sipW,tasA	yqxM-sipW-tasA	2552197..2552251	-24.6	CAAAA<left>GAGGAGUUAGUGCCU</left>CUGCUC<right>AGGCACUACUCCUC</right>UUUUUGGGAUUUUCU	lacZ transcriptional fusions; Northern blotting (2.5 kb transcript); upstream and downstream genes are on the opposite strand	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); 10464223 (Stover & Driks, J. Bacteriol. 1999, 181(17):5476-5481)	internal promoters may exist. SubtiList proposes the terminator TTAATAACAGCAAAAAAAA<left>GAGACGGCCCAGTAT</left>TCAT<right>ATACTGGGCCGTCTC</right>GATGGTTATTGACAAAAGAGG (dG = -32.6 kcal/mole) at position 2552243..2552316.
yqzG	yqzG	2555068..2555114	-11.9	AAUAA<left>GGUCCUCCA</left>UUUUU<right>UGAAGGACC</right>UUAUUCGUUUAUUUG	upstream and downstream genes are on the opposite strand	ND
comGA,comGB,comGC,comGD,comGE,comGF,comGG,yqzE	comGABCDEFG-yqzE	2554882..2554919	-16.1	GAACA<left>GUACCUGU</left>GCGA<right>GCGGGUAC</right>CUUUUUUUUGCUUCUU	S1 nuclease mapping; Northern blotting (5.0 kb transcript)	2507524 (Albano et al., J. Bacteriol. 171(10): 5386-5404, 1989); 2551886 (Albano et al., J. Bacteriol. 171(10): 5376-5385, 1989)
yqxL	yqxL	2559476..2559512	-16.8	AUCUA<left>GCAGGCAUGG</left>UGA<right>CCAUGUCUGC</right>UUUUUUAUUUAUAGG	proposed	2507524 (Albano et al., J. Bacteriol. 171(10): 5386-5404, 1989)
yqhA	yqhA	2562132..2562175	-19.5	UAGCA<left>GCUGAACAGCCU</left>UUCAC<right>GGGCUAUUCAGC</right>UUUUUUAACUUCUAU	ND	ND
yqgZ	yqgZ	2563210..2563266	-24.7	AAAAA<left>CCGAAGAUCCGCUGAUUU</left>AUAC<right>GAAUCAGCUUAUCUUCGG</right>UUUUUCACCUGUCCA	ND	ND
pstS,pstC,pstA,pstBA,pstBB	pstSCABABB	2576410..2576457	-11.9	AAAAA<left>CAGGCUG</left>AGU<right>CAGCCUG</right>UUUUUUUAUCGUGUU	Northern blotting (4.4 kb transcript)	15289558 (Allenby et al., Microbiology 2004, 150(Pt.8):2619-2628)	mRNA produced by this operon is rapidly degraded, except for pstS
yqfZ,yqfY	yqfZY	2589464..2589516	-16.9	AAAAA<left>GCUUGACGG</left>GAAC<right>CCGUCAAGC</right>UUUUUUGUGUUAGAA	proposed	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)
yqfS,yqfU	yqfSU	2591146..2591202	-15.7	GAAAA<left>UGGCUUGCUG</left>GACAGA<right>CAGCUGCCA</right>UUUUCUUUUUCAUAC	Northern blotting (2.3 kb transcript)	12486072 (Urtiz-Estrada et al., J. Bacteriol. 2003, 185(1):340-348)	The gene yqfT is located between yqfS and yqfU, but is transcribed in the opposite direction.
yqxD,dnaG,sigA	yqxD-dnaG-sigA	2599410..2599462	-18.4	AAGAU<left>GGAACGGGUCU</left>UGA<right>AGAUCCGUUCU</right>UCUUUUUUUAAAAAGAU	subcloning into a terminator-probe plasmid	3086839 (Wang & Doi, Nucleic Acids Res. 1986, 14(10):4293-4307); 3298998 (Wang & Doi, Mol. Gen. Genet. 1987, 207(1):114-119)	Internal promoters in front of dnaG and sigA. For the dnaG-sigA transcript, dnaG is transcribed but not translated.
antE	antE	2602601..2602657	-4.5	CUUUAGUGCAAAA<left>UCCCUUC</left>AUCGUUC<right>GACAGGA</right>UUUUUUGCAGCAGUG	transcription terminator probe vector	9864351 (Wang et al., J. Bacteriol. 1999, 181(1):353-356)	The antE coding region overlaps the dnaG gene located on the opposite strand; the terminator is located between dnaG and yqxD. The stem-loop contains a sequence of three mismatched basepairs.
cdd	cdd	ND	ND	ND	ND	ND
yqfC,yqfD	yqfCD	ND	ND	ND	proposed	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)
yqeZ,yqfA,yqfB	yqeZ-yqfA-yqfB	2616184..2616250	-20.9	UAGAA<left>CCUCCUUUCAAAUCAU</left>ACAC<right>AUGAGAUGAAAGGGGG</right>UUCUUUUUGUAUGGG	proposed	11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457); SubtiList
hrcA,grpE,dnaK,dnaJ,yqeT,yqeU,yqeV	hrcA-grpE-dnaKJ-yqeTUV	2620867..2620921	-13.2	AAAAA<left>UCGGUGCAU</left>UAAA<right>AUGUACCGA</right>UUUUUUUAUUUAGCC	Northern blotting (8.0 kb transcript)	9023197 (Homuth et al., J. Bacteriol. 1997, 179(4):1153-1164); 11976317 (Condon et al., J. Bacteriol. 2002, 184(10):2845-2849); Genbank D83717; Genbank X52064	A readthrough terminator TCTGATTCAATGATT<left>AGAAAGTCAAAG</left>TCAGGCATCTCTTGG<right>CTTTGACTTTTT</right>TTCTTGCCCGGGATAAAAGGA exists downstream of dnaK at 2625203..2625277, leading to a 3.5 kb hrcA-grpE-dnaK transcript. An internal promoter upstream of dnaJ leads to a 4.3 kb dnaJ-yqeTUV transcript.
spoIIP,yqxA	spoIIP-yqxA	2632047..2632089	-4.8	GAUAU<left>GAUAG</left>GGAA<right>CUUUUC</right>UCUUUCUUGUUUUACAU	proposed	7836306 (Frandsen & Stragier, J. Bacteriol. 1995, 177(3):716-722); Genbank D17650	Terminator sequence differs slightly from the sequence indicated in Genbank.
gpr	gpr	ND	ND	ND	ND	1840582 (Sussman & Setlow, J. Bacteriol. 1991, 173(1):291-300); 7836306 (Frandsen & Stragier, J. Bacteriol. 1995, 177(3):716-722); Genbank D17650
comEA,comEB,comEC	comEABC	ND	ND	ND	S1 nuclease mapping	7968523 (Hahn et al., Mol. Microbiol. 10(1): 99-111, 1993); SubtiList	A minor promoter exists between comEA and comEB. The terminators proposed in the paper do not agree well with the S1 nuclease mapping result. A second termination site was found experimentally by Hahn et al. about 230 basepairs from the stop codon.
comER	comER	2641300..2641346	-12.4	AAAAA<left>CCAUCGUUU</left>UAGG<right>AAACGAUGG</right>UUUUUGAUUUCUGCG	S1 nuclease mapping	7968523 (Hahn et al., Mol. Microbiol. 10(1): 99-111, 1993)	S1 nuclease mapping showed that transcription ends near the indicated stem-loop.
cwlH	cwlH	2648071..2648119	-16.5	ACGGA<left>UAACCUGUUUCC</left>AGUGC<right>GGAUUCAGGUUA</right>UUUUCUUUUCUUUGG	Northern blotting (0.8 kb transcript)	10515909 (Nugroho et al., J. Bacteriol. 1999, 181(20):6230-6237)	listed as yqeE in DBTBS
nucB	nucB	2651562..2651625	-16.4	CAGUAGUAAAGA<left>AGAGGCUC</left>UUUCUU<right>GAGCCUCU</right>GUUGUUACAAUCCUUC	proposed	7746143 (Van Sinderen et al., Mol. Microbiol. 1995, 15(2):213-223)
spoIVCB,spoIIIC	spoIVCB-spoIIIC	2700967..2701021	-11.6	AAGAA<left>GCCGGA</left>UCUCAUAC<right>UCCGGC</right>UUUCUCUAUUUGAAA	upstream and downstream genes are in opposite directions	2536191 (Stragier et al., Science 1989, 243(4890):507-512); 3125151 (Errington et al., J. Bacteriol. 1988, 170(3):1162-1167)	spoIVCB and spoIIIC form a composite gene in the mother cell during sporulation by excising the intervening DNA sequence.
spoIVCA	spoIVCA	2652567..2652626	-11.8	AAAGA<left>GGGGUG</left>UAUG<right>CACCCC</right>CCUUUUGUAAUUACAAU	proposed	2105293 (Sato et al., J. Bacteriol. 1990, 172(2):1092-1098)
arsR,yqcK,arsB,arsC	arsR-yqcK-arsBC	2654499..2654535	-13.0	UUAAA<left>GGAUGCAUA</left>UUUA<right>UAUGUGUCC</right>UUUUUUUAUUAAUGU	Northern blotting (2.4 kb transcript)	9537360 (Sato & Kobayashi, J. Bacteriol. 1998, 180(7):1655-1661)
rapE,phrE	rapE-phrE	2659715..2659752	-8.9	CUUUA<left>GCCGUU</left>UCAU<right>AACGGC</right>UUUUUCUUAUUUCUA	proposed	10629174 (Jiang et al., J. Bacteriol. 2000, 182(2):303-310); 11466295 (McQuade et al., J. Bacteriol. 2001, 183(16):4905-4909); Genbank 	Internal promoter in front of phrE.
blt,bltD	blt-bltD	ND	ND	ND	Northern blotting (2.0 kb transcript)	7608059 (Ahmed et al., J. Bacteriol. 1995, 177(14):3904-3910)
azlB,azlC,azlD,brnQ,yrdK	azlBCDbrnQyrdK	2726046..2726094	-8.9	AAAAA<left>GCAAACU</left>ACAUACCGA<right>AGUUUGC</right>UUUUUUGCUCUAUAC	lacZ transcriptional fusions; Northern blotting (3.5 kb transcript)	9287000 (Belitsky et al., J. Bacteriol. 1997, 179(17):5448-5457)	This operon contains at least one internal promoter somewhere downstream from azlC (presumably in the 165 basepair gap between azlD and yrdK); Genbank U93876 shows another potential terminator in this gap.
levD,levE,levF,levG,sacC	levDEFG-sacC	2757221..2757270	-17.4	AAAAA<left>GGCACAGAC</left>CCGAACA<right>GUCUGUGCC</right>UUCUUGUUAUUUUAA	5' primer extension mapping of the sacC gene	2495266 (Martin et al., J. Bacteriol. 1989, 171(4):1885-1892); 3112519 (Martin et al., Mol. Gen. Genet. 1987, 208(1-2):177-184)
yrhI,yrhJ	yrhIJ	2773078..2773120	-19.3	UAAAA<left>UCCCGCCAAU</left>CUG<right>AUUGGCGGGA</right>UUGCUUUGCAUAUGA	proposed	10917605 (Palmer et al., Biochem. Soc. Trans. 1999, 27(4):374-378); Genbank U93874
yrhH	yrhH	2777049..2777108	-15.7	GGAAA<left>UAUAUCCAAGAUCCU</left>CGUAUU<right>AGGAUUUGGGUAUA</right>UUUUCUUAAUUUUUU	proposed	9636707 (Huang et al., J. Mol. Biol. 1998, 279(1):165-173); 9683469 (Huang et al., J. Bacteriol. 1998, 180(15):3765-3770); SubtiList
glnQ,glnH,glnM,glnP	glnQHMP	2804532..2804575	-13.4	GAAAA<left>GGAUACUCU</left>UUGG<right>AGAGUAUCC</right>UUUUUGCAUUAAAAC	Northern blotting (3.0 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); Genbank Z69371	A potential readthrough terminator TGAATAACAACCATCCC<left>GGGATGAGCA</left>GGCGA<right>TGCTCATCCC</right>AATTTGATAAGGAGTGAATAGGCAGATGAATG was found downstream of glnH at position 2803150..2803223, leading to a 1.8 kb transcript.
yrvJ	yrvJ	2819262..2819309	-12.0	AAAAA<left>GCUGCC</left>UUUU<right>GGCAGC</right>UUUUUUUAUUUUGAA	proposed	9383190 (Wendrich & Marahiel, Mol. Microbiol. 1997, 26(1):65-79)	bidirectional terminator
relA,yrvI	relA-yrvI	2819272..2819315	-12.2	AAAAA<left>GCUGCC</left>AAAA<right>GGCAGC</right>UUUUUUUAUUGGAAG	proposed	9383190 (Wendrich & Marahiel, Mol. Microbiol. 1997, 26(1):65-79)	bidirectional terminator
yrvD	yrvD	ND	ND	ND	proposed	15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107)
yrvE,apt	yrvE-apt	2822070..2822117	-8.8	AAAAA<left>GCACUC</left>CAUGUCA<right>GGGUGC</right>UUUUUUCCUAUUGUU	Northern blotting (3.0 kb transcript)	15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107)	Internal promoter in front of apt, leading to a 0.6 kb transcript. Readthrough at this terminator leads to a 5.8 kb yrvE-apt-relA-yrvI transcript and a 3.3 kb apt-relA-yrvI transcript.
spoVB	spoVB	ND	-8.1	CGAUA<left>AUGGUCAC</left>GUGCG<right>GUGCCCAU</right>CUUUUUCAUCAAUAUA	upstream and downstream genes are in opposite directions	1744050 (Popham & Stragier, J. Bacteriol. 1991, 173(24):7942-7949)
csbX,bofC	csbX-bofC	2836097..2836132	-6.9	UUGAA<left>GACAUG</left>UAUU<right>CAUGUC</right>UUUUUUUUCGUGAAA	insertional mutant and examination of bofC expression; plasmids and merodiploid	9099855 (Gomez & Cutting, Gene 1997, 188(1):29-33); 9025289 (Gomez & Cutting, Microbiology 1997, 143(Pt.1):157-170)	internal promoter in front of bofC.
yrbD	yrbD	2842284..2842335	-13.4	UAAAA<left>CCGGCCCGA</left>UAUGACC<right>UCGUGCCGG</right>UUUUUUAUGAACGAU	Northern blotting (1.5 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); SubtiList
safA,coxA	safA-coxA	2843112..2843161	-19.5	GGAAG<left>GGCUGCCGGA</left>AGUGAUA<right>UUCGGCAGCC</right>UUUUUCUUUGCAUCA	Northern blotting (2.0 kb transcript)	10438771 (Takamatsu et al., J. Bacteriol. 1999, 181(16):4986-4994)	readthrough terminator downstream of safA, leading to a 1.2 kb safA monocistronic transcript; internal promoter in front of coxA leads to a 0.7 kb coxA monocistronic transcript.
nadB,nadC	nadBC	ND	ND	ND	insertional plasmid	8444804 (Sun & Setlow, J. Bacteriol. 1993, 175(5):1423-1432)
nifS,yrxA	nifS-yrxA	2850469..2850512	-7.6	AAAAA<left>GCCC</left>UCUAGU<right>GGGC</right>UUUUUUUAUAAUUGG	proposed	8444804 (Sun & Setlow, J. Bacteriol. 1993, 175(5):1423-1432)	bidirectional terminator
pheB,pheA	pheBA	2850480..2850531	-7.8	AAAAA<left>GCCC</left>ACUAGA<right>GGGC</right>UUUUUUUAGUCUUUA	S1 protection	2537815 (Trach & Hoch, J. Bacteriol. 1989, 171(3):1362-1371); 8444804 (Sun & Setlow, J. Bacteriol. 1993, 175(5):1423-1432)	Bidirectional terminator. S1 protection assay showed that pheB and pheA belong to the same operon, but did not fix the location of the terminator. Internal promoter in front of pheA.
spo0B,obg	spo0B-obg	2851842..2851884	-20.5	UGAAA<left>AGAGAGCCUG</left>GUGC<right>CAGGCUCUCU</right>AUUUUAAAGGGGGGAU	S1 protection	2537815 (Trach & Hoch, J. Bacteriol. 1989, 171(3):1362-1371) Readthrough, antitermination, or RNA processing may occur, leading to a spo0B-obg-pheBA transcript. The S1 protection assay showed that termination occurs at the indicated stem-loop.
rpmA	rpmA	2854064..2854111	-14.8	AAAAA<left>CUCCGGUC</left>GAUGAU<right>GACUGGAG</right>UUUUUUUUGCAAUAU	proposed	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
spoIVFA,spoIVFB	spoIVFAB	2855157..2855189	-9.1	CUAAA<left>ACUGAUUGACAA</left>ACGCC<right>UUGUAUUUUGGU</right>AUAUUUUUUAAUGUUAUG	transcriptional fusions	1942049 (Cutting et al., J. Mol. Biol. 1991, 221(4):1237-1256)	The transcriptional fusions show that the transcript does not extend more than 74 base pairs from the spoIVFB stop codon.
mreB,mreC,mreD,minC,minD	mreBCD-minCD	2856942..2856998	-15.6	AAGAA<left>UCUGACAAAGC</left>AUAU<right>GCUGUGUCAGG</right>UUUUUUUUUGUUUUU	integrative plasmids	1400225 (Varley & Stewart, J. Bacteriol. 1992, 174(21):6729-6742); 8459776 (Lee & Price, Mol. Microbiol. 1993, 7(4):601-610); 1942049 (Cutting et al., J. Mol. Biol. 1991, 221(4):1237-1256)	Internal promoter in front of minC. The downstream gene spoIVFA most likely belongs to a different operon. However, this was not verified experimentally.
radC	radC	ND	ND	ND	ND	ND
comC	comC	2863593..2863635	-11.9	UUUUU<left>GGACAAGGC</left>GACAAAA<right>GUCUUGUUC</right>UUUUUUUCUUUGCCU	S1 nuclease mapping; Northern blotting (0.8 kb transcript)	1694528 (Mohan & Dubnau, J. Bacteriol. 1990, 172(7): 4064-4071); 2553669 (Mohan et al., J. Bacteriol. 1989, 171(11):6043-6051)	S1 nuclease mapping showed that termination occurs near the center of the TTTTTTT stretch.
valS,folC	valS-folC	2864491..2864534	-18.1	GGCUC<left>CGGCAGAAUC</left>AAAAAAA<right>GAUUCUGCCG</right>UUUUUUUCAUGUGUA	Northern blotting (4.4 kb transcript)	9098041 (Luo et al., J. Bacteriol. 1997, 179(8):2472-2478); Genbank L04520	A readthrough terminator GTTAATGAA<left>AAGCCGGGGCGGTTTCT</left>AG<right>AGAAACCGCCTTGTCTT</right>ATAAAAGAG was found at position 2865841..2865894 downstream of valS, leading to a 3.0 kb monocistronic valS transcript.
spoVID,ysxE	spoVID-ysxE	2868567..2868614	-23.5	CGAAA<left>GAGCUUUUCGUCCU</left>UUUACA<right>GGGAUGAAGAGCUC</right>UUUUUUCGUUCUCAG	transcriptional fusion of ysxE with lacZ; Northern blotting of the downstream valS gene	8449878 (Beall et al., J. Bacteriol. 1993, 175(6):1705-1716); 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078); 9098041 (Luo et al., J. Bacteriol. 1997, 179(8):2472-2478)
hemA,hemX,hemC,hemD,hemB,hemL	hemAXCDBL	2871904..2871957	-15.8	GAAAA<left>CCGGUAUCAAGG</left>ACU<right>CCUUGUGCCGG</right>UUUUUUCGUGCUCUC	genetic modification of hemL	1672867 (Hansson et al., J. Bacteriol. 1991, 173(8):2590-2599)
ysxD	ysxD	2878922..2878966	-16.7	UAAAA<left>CCGGUAGAG</left>GAUC<right>CUCUACCGG</right>UUUAUCAUUUUUUUG	proposed	7961402 (Riethdorf et al., J. Bacteriol. 1994, 6518-6527)	bidirectional terminator
lonA,ysxC	lonA-ysxC	2878924..2878968	-16.7	AUAAA<left>CCGGUAGAG</left>GAUC<right>CUCUACCGG</right>UUUUAUUUAUCGUAU	proposed	7961402 (Riethdorf et al., J. Bacteriol. 1994, 6518-6527)	bidirectional terminator
lonB	lonB	2882009..2882046	-8.9	UUAAA<left>CCCUAUU</left>UUGAU<right>AAUAGGG</right>UUUUUUUCAUGAAGG	Northern blotting (1.7 kb transcript)	11325926 (Serrano et al., J. Bacteriol. 2001, 183(10):2995-3003); 7961402 (Riethdorf et al., J. Bacteriol. 1994, 176(21):6518-6527)
clpX	clpX	2883800..2883850	-24.9	ACAAA<left>CCUCCUGAGUG</left>GUAA<right>CACUCAGGAGG</right>UUUUUUUGCAUGCAA	Northern blotting (1.4 kb transcript)	8973311 (Gerth et al., Gene 1996, 181(1-2):77-83); 11325926 (Serrano et al., J. Bacteriol. 2001, 183(10):2995-3003); 10411757 (Liu et al., Mol. Microbiol. 1999, 33(2):415-428)
tig	tig	2885323..2885370	-13.0	AACAG<left>GGCGCGAA</left>UCA<right>UUCGUGCC</right>UUGUUUUCGUACAAU	proposed	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
ilvB,ilvH,ilvC,leuA,leuB,leuC,leuD	ilvBHC-leuABCD	2887967..2888016	-13.5	AAAAA<left>GCGGCCGGU</left>AUUU<right>GUCCGGCGGC</right>UUUUUUUGCCUGGUG	Northern blotting (8.5 kb transcript)	15060025 (Mader et al., J. Bacteriol. 2004, 186(8):2240-2252)	RNA processing leads to a 5.8 kb ilvC-leuABCD transcript. A readthrough terminator CATCA<left>TTGAAGCGGG</left>ATTT<right>CCCGCTTCG</right>TCCCGAGGTGACTTTTTAGCTGTTCAGGA downstream of ilvC at 2892584..2892640 leads to a monocistronic 1.2 kb ilvC transcript.
ysnE	ysnE	2897811..2897869	-18.1	AUAAG<left>GAUAGAUAAGUGCAGG</left>GGAAGG<right>UCUGUCUUAUCUAUC</right>UUUUUUUAUAUUCAC	proposed	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
ysnF	ysnF	2898822..2898876	-17.2	AAAAA<left>CCUCAAAUCC</left>UAAAU<right>GGAUUUGAGG</right>UUUUUCUUUUGGUAC	proposed; downstream genes are on the opposite strand	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
ysnB	ysnB	ND	ND	ND	proposed	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)	The terminator proposed by Wipat et al. lacks a T-stretch.
gerM	gerM	2901006..2901062	-10.7	AGAAA<left>GAGGUUAGC</left>GUUCCG<right>GCUGCCUC</right>UUUCUUUAUUCAAUU	proposed	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
gerE	gerE	2903747..2903795	-18.5	CCUUG<left>CCGGUAUUCCUUCU</left>UUU<right>GGAAGGAGCCGG</right>UUAUUGCUGUUUGUU	integrational plasmids; Northern blotting (0.3 kb transcript)	3114423 (Cutting & Mandelstam, J. Gen. Microbiol. 1986, 132(Pt.11):3013-3024)
sdhC,sdhA,sdhB	sdhCAB	2904601..2904649	-13.9	AAAAA<left>CCUCUUCC</left>GCAU<right>GGGAGAGG</right>UUUUUUUAAACAAUA	Northern blotting (3.45 kb transcript)	3027051 (Phillips et al., J. Bacteriol. 1987, 169(2):864-873); 3114423 (Cutting & Mandelstam, J. Gen. Microbiol. 1986, 132(Pt.11):3013-3024); 3036777 (Melin et al., J. Bacteriol. 1987, 169(7):3232-3236)
yslB	yslB	2908530..2908584	-15.8	AAAAA<left>GGCGGUGACU</left>GCAU<right>AGUCCCGCC</right>UUUUUGAUUGUCAUU	proposed	3036830 (Chen et al., J. Biol. Chem. 1987, 262(18):8787-8798)	bidirectional terminator
lysC	lysC	2908544..2908591	-15.7	AAAAA<left>GGCGGGACU</left>AUGC<right>AGUCACCGCC</right>UUUUUGAUUACACUG	proposed	3036830 (Chen et al., J. Biol. Chem. 1987, 262(18):8787-8798)	Bidirectional terminator.
trxA	trxA	2912037..2912081	-14.0	CCAGA<left>GCGAUUCC</left>GAUUGA<right>GGGAUCGC</right>UUUUUUUAUUCGCCA	Northern blot (0.6 kb transcript for the SigB promoter, 0.38 kb transcript for the SigA promoter)	9537387 (Scharf et al., J. Bacteriol. 1998, 180(7):1869-1877); 2559145 (Chen et al., J. Gen. Microbiol. 1989, 135(Pt.11):2931-2940)
xsa	xsa	2912687..2912736	-20.7	CGCAA<left>GAGCGCCGG</left>AGCUUCAUG<right>CCGGCGCUC</right>UUUUUCAGGUUUUAA	Northern blotting (1.6 kb transcript)	9537387 (Scharf et al., J. Bacteriol. 1998, 180(7):1869-1877); 14973026 (Raposo et al., J. Bacteriol. 2004, 186(5):1287-1296)
etfA	etfA	2914396..2914444	-16.4	GAAAU<left>CCCGGACUU</left>UAA<right>AAGUCCGGG</right>UUUUUUCAUAUUUAU	proposed	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078); 14973026 (Raposo et al., J. Bacteriol. 2004, 186(5):1287-1296)
lcfA	lcfA	ND	ND	ND	ND	ND
yshE	yshE	2919454..2919506	-4.2	AAAAA<left>GAAAG</left>AUUUAC<right>CUUUC</right>UUUUUCUUUUUUUUG	proposed	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
yshB	yshB	2924137..2924179	-10.3	AAAAA<left>CUUCUCU</left>UGUCC<right>GGAGAAG</right>UUUUUUUCAAGUAUG	proposed	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
rnhC	rnhC	2926024..2926076	-16.1	AAAAA<left>GCUUGCAGA</left>UUUC<right>UCUGCAAGC</right>UUUUUUAUCAGCCUC	proposed; upstream and downstream genes are on the opposite strand	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)	bidirectional terminator
pheT	pheT	2926037..2926089	-18.8	AAAAA<left>GCUUGCAGA</left>GAAA<right>UCUGCAAGC</right>UUUUUUCUAUGAACG	proposed; downstream gene is on the opposite strand	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)	bidirectional terminator
ysgA	ysgA	2929586..2929635	-17.8	CACAA<left>CUCGUCCCUU</left>GUAC<right>AAGGGACGGG</right>UUUUUUUUAUUUUCC	proposed	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
sspI	sspI	2930977..2931012	-13.6	UGAAA<left>CCGGGUG</left>ACAG<right>CGCCCGG</right>UUUUUUUCUUAUAUA	proposed	10806362 (Cabrera-Hernandez, Gene 2000, 248(1-2):169-181)
ysfD	ysfD	2934980..2935031	-17.6	AGAAA<left>GCCCAAAACA</left>GACAU<right>UGUUUUGGGC</right>UUUUGUGCGUUAUUC	proposed; downstream genes are on the opposite strand	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)	bidirectional terminator
ysfE	ysfE	2934985..2935032	-17.6	CAAAA<left>GCCCAAAACA</left>AUGUC<right>UGUUUUGGGC</right>UUUCUCAUGAUGUUU	proposed; downstream genes are on the opposite strand	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)	bidirectional terminator
araA,araB,araD,araL,araM,araN,araP,araQ,abfA	araABDLMNPQ-abfA	2937356..2937412	-16.4	GCAAA<left>GCCGGAGA</left>UUUC<right>UCUCCGGC</right>UUGUCUUUCAACUGC	Northern blotting (11.0 kb transcript)	9084180 (Sa-Nogueira et al., Microbiology 1997, 143(Pt.3):957-969); Genbank X89810	premature transcription termination or internal promoters may have lead to other detected mRNA lengths. One more putative terminator is listed in the Genbank record.
abnA	abnA	2948095..2948135	-12.0	UGAAUAAAAA<left>GCCGGG</left>CUCUGCC<right>CCCGGC</right>UUUUUUUAAAAGAAA	Northern blotting (0.9 kb transcript)	14973026 (Raposo et al., J. Bacteriol. 2004, 186(5):1287-1296); SubtiList
ysdB	ysdB	2950921..2950975	-4.8	GAAGA<left>GCGU</left>UAA<right>ACGC</right>UUUUCUGCUUUUUAU	upstream and downstream genes are on the opposite strand	9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371); 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)	bidirectional terminator
ysdA	ysdA	2950936..2950989	-17.7	AAAAA<left>GCAGAAAAGCGU</left>UUA<right>ACGCUCUUCUGC</right>UUUUUUUGCGAGUUU	proposed; downstream gene is on the opposite strand	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)	bidirectional terminator
rplT	rplT	2951259..2951294	-16.5	AUAGA<left>GCCGCUCU</left>CCAGC<right>AGAGCGGC</right>UUUUUCUAUAUAAAG	proposed	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
yscB	yscB	2953484..2953539	-17.1	AAAAA<left>GCCAAGGC</left>AUUCA<right>GCCUUGGC</right>UUAUCCUCCGAUCAG	Northern blotting (0.6 kb transcript)	15033535 (Serizawa et al., Gene 2004, 329:125-136)	Bidirectional terminator. A 0.9 kb yscAB transcript was also detected.
ysbB	ysbB	2953500..2953552	-16.9	GAUAA<left>GCCAAGGC</left>UGAAU<right>GCCUUGGC</right>UUUUUUUAUUUUAUG	proposed	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)	bidirectional terminator
lytT	lytT	2954806..2954852	-15.3	AAAAA<left>GCUGCUCCAU</left>AUUUG<right>AUGGGCGGC</right>UUUUUGCAUUUCAGC	proposed	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
ysaA	ysaA	2958245..2958297	-17.6	AAAAA<left>GCAUGAUCUC</left>UUCAAU<right>GAGAUCAUGC</right>UUUUUUAUUUUAUUU	proposed; upstream and downstream genes are on the opposite strand	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)	bidirectional terminator
thrS	thrS	2958252..2958314	-17.9	AAAAA<left>GCAUGAUCUC</left>AUUGAA<right>GAGAUCAUGC</right>UUUUUUUAUUUCUCU	proposed; downstream gene is on the opposite strand	8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)	bidirectional terminator
ytxC	ytxC	2960251..2960291	-19.3	UUCAA<left>CCUCGUCCCU</left>UUCAUA<right>GGGGGCGGGG</right>UUUUUAUAUGCAAAA	proposed	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972); 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
ytcG	ytcG	2964686..2964728	-11.9	UAAAA<left>GAGCUAAGAGG</left>AUU<right>CUUCUAGCUC</right>UUUUCUCAUGUGCAA	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
gapB,speD	gapB-speD	2965389..2965445	-30.1	CAAAG<left>GGAGCUGAAGCUAGAAAGCCA</left>UUA<right>UGCGCUUUUUAGCUUAUGCUCC</right>UUUUAUUUUUAUAAA	Northern blotting (1.8 kb transcript)	10844697 (Sekowska et al., Mol. Microbiol. 2000, 36(5):1135-1147)	internal promoter in front of speD leads to a 0.6 kb monocistronic speD transcript.
ytaG	ytaG	2969925..2969971	-15.1	AAAAA<left>CACCGUUCA</left>UAU<right>UGAACGGUG</right>UUUUUUGGCCAUUAA	proposed; downstream genes are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
phoP,phoR	phoPR	2974979..2975022	-16.3	UUGAC<left>GGCGGGAAC</left>CUAUUUGU<right>GUUCCCGUC</right>CUUUUUUGUGUCUUCU	Northern blotting (2.7 kb transcript)	3142862 (Seki et al., J. Bacteriol. 1988, 170(12):5935-5938); 14762014 (Pragai et al., J. Bacteriol. 2004, 186(4):1182-1190)
citZ,icd,mdh	citZ-icd-mdh	2977730..2977781	-4.8	AGAAA<left>GGCU</left>UGCUUAAUAC<right>AGCC</right>UUUCUCUUUUUACUA	proposed	8045898 (Jin & Sonenshein, J. Bacteriol. 1994, 176(15):4669-4679);  8550482 (Jin et al., J. Bacteriol. 1996, 178(2):560-563); 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220	internal promoters in front of icd and mdh
ytwI	ytwI	2981610..2981661	-10.0	AAAAA<left>GCGGC</left>CUUAAA<right>GCCGC</right>UUUUUUUUAUGCAAA	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytvI	ytvI	2983305..2983356	-19.5	UAAAA<left>CGGCAGCCGU</left>UUUUUC<right>AUGGCUGCCG</right>UUUUUUAUUUGAUGA	upstream and downstream genes are in the opposite direction	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972); SubtiList
pfkA,pyk,ytzA	pfkA-pyk-ytzA	2983312..2983365	-18.2	AAAAA<left>CGGCAGCC</left>AUGAAAAAAC<right>GGCUGCCG</right>UUUUAUUUUUGCUGA	Northern blotting (3.5 kb transcript)	11489127 (Ludwig et al., Mol. Microbiol. 2001, 41(2):409-422); Genbank AF008220; SubtiList	A readthrough terminator CGAGCGTTCTTTAATTACAGGT<left>GAAAATGGAAGGG</left>GAAT<right>CCCTTCCTTTTC</right>TCTTTATCATGCCTTTTGTTGA exists downstream of pyk at 2983768..2983840, leading to a 2.8 kb transcript.
accA	accA	2986735..2986779	-11.4	AUAAA<left>CGUGAAGCC</left>UUU<right>GGCUCACG</right>UUUAUUUUUUGUGAC	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytsJ	ytsJ	2988801..2988876	-32.9	ACUGA<left>CGGCUGAAAUUUUUUUAGGG</left>GGUUAG<right>CCUUAAAAAAAUUUCAGCCG</right>GGUUUAACAUUAUUUUU	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytrH,ytrI	ytrHI	ND	ND	ND	5' RACE-PCR of the downstream ytrI gene; gene downstream of ytrI is on the opposite strand	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)	ytrH gene was discovered by Eichenberger
ytqI	ytqI	2994923..2994954	-16.9	UAAAGAACAC<left>GAGUAGAGGG</left>GAGA<right>CCCUCUCUC</right>UUAGUGUUCAUCUGU	proposed; upstream and downstream gene are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220	bidirectional terminator
ytoI	ytoI	2996275..2996320	ND	ND	proposed; downstream gene is on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220; SubtiList	The terminator proposed in the Genbank record lacks a T-stretch.
ytmI,ytmJ,ytmK,ytmL,ytmM,ytmN,ytmO,ytnI,ytnJ,ribR,ytnL,ytnM	ytmIJKLMNO-ytnIJ-ribR-ytnLM	2997735..2997764	-10.6	UGUAA<left>GAAGCC</left>GGUCG<right>GGCUUC</right>UUUUUUAUUUUCCAG	Northern blotting (transcript length between 10 kb and 11 kb)	15272571 (Solovieva et al., Russian Journal of Genetics 2004, 40(5):580-583; Genetika 2004, 40(5):716-720); SubtiList
ytlI	ytlI	ND	ND	ND	proposed; downstream gene is on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220; SubtiList	The terminator listed in Genbank and SubtiList lacks a T-stretch
ytkL	ytkL	3008907..3008967	-19.5	UGAAA<left>CCAUCUCCUGA</left>UGAA<right>UCAGGAGGUGG</right>UUUUUAUUUUUUCAG	proposed; upstream and downstream genes are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220; SubtiList	bidirectional terminator
moaB	moaB	3013503..3013555	-14.3	UGAAA<left>CUUCACCUGA</left>AAU<right>UUAGGUGAAG</right>UUUUUUUUAUAAAAG	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220; SubtiList
ackA	ackA	3014110..3014160	-12.5	UGAAA<left>GCACAUUC</left>UCUU<right>GAAUGUGC</right>UUUUUUGUUGAUGCA	proposed	8226682 (Grundy et al., J. Bacteriol. 1993, 175(22):7348-7355)
ytxK	ytxK	ND	-19.8	UAAAA<left>GCAGCUUAGACAGCC</left>GUAUGA<right>GGUCGAUGCCUAAGCUGC</right>UUUUAUUUAUGCUUU	proposed	8226682 (Grundy et al., J. Bacteriol. 1993, 175(22):7348-7355)
tpx	tpx	3016693..3016742	-14.6	AAAAA<left>GCUCCAGGC</left>UGCC<right>GCCGGAGC</right>UUUUUUCAUGGCAAG	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220; SubtiList
ytfJ	ytfJ	3017309..3017361	-15.2	AAAAG<left>GUUAACUGCG</left>CUGGC<right>CGCAGUUAAC</right>UUUUUUUUGGCAUAA	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
sppA,yteJ	sppA-yteJ	3018536..3018568	-14.7	GAUAA<left>CCCGGAC</left>UUCC<right>GUCCGGG</right>UUUAUUUUUUUAGGA	proposed	Genbank AF008220; 9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371)
ytcJ	ytcJ	3021076..3021117	-16.8	UAAAA<left>GGACAGGC</left>AGCA<right>GCCUGUCC</right>UUUUAUUUUCUAUAA	proposed; downstream gene is on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
sspA	sspA	3024426..3024464	-16.2	CUUAG<left>GAGUGGGG</left>GUAU<right>CCCCACUC</right>UUUUUCAUUUUUUAC	Northern blotting (295 bp transcript)	3009398 (Connors et al., J. Bacteriol. 1986, 166(2):417-425)
braB	braB	3028668..3028718	-18.7	CAGAA<left>CGCCUGCGU</left>UAUU<right>GCGCAGGCG</right>UUUUGUAAUAAAAAA	proposed; upstream and downstream gene are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ezrA	ezrA	3028717..3028771	-11.7	AAAAA<left>GAGCCCGC</left>AGUGUAAUGA<right>GCAGGCUC</right>UUUUUUUAUUACAAA	proposed; upstream and downstream gene are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
yttP	yttP	3031375..3031409	-5.6	UCAGA<left>CCC</left>AAACACAAGC<right>GGG</right>AUCUUCUUUUGCUUCGCU	upstream and downstream gene are on the opposite strand	ND
ytsP	ytsP	3032698..3032744	-15.4	UAAAA<left>GCCCAAAAC</left>UGAUAUC<right>GUUUUGGGC</right>UUUUUUUAUUUUAUU	proposed; upstream and downstream gene are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytrP	ytrP	3032699..3032756	-16.1	AAAAA<left>GCCCAAAAC</left>GAUAUCA<right>GUUUUGGGC</right>UUUUAUAUUACUGCG	proposed	Genbank AF008220
rpsD	rpsD	3035369..3035435	-17.3	AAAAA<left>CCCCUGCCGC</left>UAU<right>GCGGUCGGGG</right>UUUUUUUAUCGGCUU	Northern blotting (0.8 kb transcript)	1699930 (Grundy et al., J. Bacteriol. 1990, 172(11):6372-6379)
tyrS	tyrS	3035602..3035660	-20.7	AAAAA<left>GAUCCUUUGCC</left>ACUGAA<right>GGCAAAGGAUC</right>UUUUUGUUUACCGCA	proposed	1735721 (Henkin et al., J. Bacteriol. 1992, 174(4):1299-1306)
acsA	acsA	3036937..3036978	-22.5	UCAAU<left>CGUCCCUUCGU</left>GUAA<right>ACGAAGGGGCG</right>UUUUUUAUUUUAAUU	proposed	7934817 (Grundy et al., Mol. Microbiol. 10(2) 259-271, 1993)
acuA,acuB,acuC	acuABC	3041577..3041634	-11.4	AAAAA<left>CGACCUUU</left>ACGA<right>AGAGGUCG</right>UUUUUGAUUUUUUAA	proposed; downstream genes are on the opposite strand	7934817 (Grundy et al., Mol. Microbiol. 10(2) 259-271, 1993)	bidirectional terminator
ytxE	ytxE	3041591..3041637	-9.1	AAAAA<left>CGACCU</left>CUUCGUAA<right>AGGUCG</right>UUUUUUACUUUGUUC	proposed; downstream genes are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220	bidirectional terminator
aroA	aroA	3044447..3044494	-12.7	CAAAA<left>GGCCGC</left>CGU<right>GCGGCC</right>UUUUUUUAUGCUUUC	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytxG,ytxH,ytxJ	ytxGHJ	3045760..3045809	-13.6	AAAAA<left>GCGUCCAGAU</left>AUC<right>AUCUGGCGC</right>UUUUUUUUGUAAAAA	plasmid integration	8733232 (Varon et al., Mol. Microbiol. 1996, 20(2):339-350)
murC	murC	3047196..3047237	-9.6	AAAAA<left>GCAGUG</left>AUCU<right>CACUGC</right>UUUUUAUUUAUCUGA	proposed	8733232 (Varon et al., Mol. Microbiol. 1996, 20(2):339-350)	maybe readthrough
malS	malS	3055858..3055909	-19.0	AAAGA<left>GCCGCUGC</left>AUAG<right>GCAGCGGC</right>UUCUAUUUUUUGCUU	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytmQ	ytmQ	3058566..3058605	-14.2	AAAGA<left>CAGACUCU</left>GACA<right>GGAGUCUG</right>UUUUUUUUAUGGGCC	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
amyX	amyX	3060621..3060688	-18.4	UAAAG<left>GACGGCUAUUGA</left>UUAGCAUAUGAGACUC<right>UCAAUAGCUGUC</right>UUUUUUAUUUUUAUA	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytjP	ytjP	3066434..3066478	-17.5	UAAAA<left>GGACCGGCUUC</left>UGCU<right>GAAGCCAGUCC</right>UUUUUUUAAAUAAAU	proposed; upstream and downstream gene are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytiP	ytiP	3069257..3069295	-12.4	AAAAA<left>CCCAAACG</left>UCGC<right>CGUUUGGG</right>UUUUUUAUGUAAACA	upstream and downstream genes are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220	bidirectional terminator
ythP,ythQ	ythPQ	3069262..3069298	-16.0	AAAAA<left>CCCAAACG</left>GCGA<right>CGUUUGGG</right>UUUUUGGUCUAUCCU	proposed	11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457); Genbank AF008220	bidirectional terminator
opuD	opuD	3077388..3077445	-20.5	AAAAA<left>GAUCUUUCCGC</left>GCCU<right>GCGGAAAGAUC</right>UUUUUAUUUGCGAUA	proposed; downstream genes are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220	bidirectional terminator
yteV	yteV	3077402..3077446	-20.6	AAAAA<left>GAUCUUUCCGC</left>AGGC<right>GCGGAAAGAUC</right>UUUUUUGUUAAUAUG	downstream genes are in the opposite direction	8990290 (Henriques et al., J. Bacteriol. 1997, 179(2):389-398)	bidirectional terminator
ytcQ	ytcQ	3084806..3084858	-7.9	CAAAA<left>CGC</left>GCAA<right>GCG</right>GUUUUGGGUUUUUUAC	proposed; downstream genes are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
bioW,bioA,bioF,bioD,bioB,bioI,ytbQ	bioWAFDBI-ytbQ	3087407..3087462	-14.9	GAACG<left>GAGCAUAAUC</left>AUUUUCUAA<right>GAUUAUGCUC</right>UUUUUCUUUUGUUAU	insertional mutagenesis; Northern blotting (7.0 kb transcript)	8763940 (Bower et al., J. Bacteriol. 1996, 178(14):4122-4130); Genbank AF008220	Readthrough terminator AAA<left>GAATCAATAAAAGCAATCGGT</left>ATGAT<right>GTCGATTGTTTTTATTTTT</right>G with dG = -17.8 kcal/mole at position 3089483..3089531 downstream of bioB, leading to a 5.0 kb bioWAFDB transcript
ytaP	ytaP	3094661..3094712	-13.9	AAAAA<left>GACCGUUUU</left>GUGUG<right>AAAACGGUC</right>UUUUUGUUUCCUUUU	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
melA	melA	3101224..3101269	-14.6	AAAAA<left>CUAGGGGA</left>CCGCUC<right>UCCCCUAG</right>UUUUUUGGUUUUGUU	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
leuS	leuS	3101638..3101685	-14.2	AAAAA<left>UCCCCUUU</left>GCCA<right>AAAGGGGA</right>UUUUUUUUCAUCAGU	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
yttB	yttB	3106221..3106303	-15.7	UAAAA<left>GAUCCCGC</left>CGAAUGA<right>GCGGGAUC</right>UUUCAGCGUGUCGAC	proposed; upstream and downstream gene are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
yttA	yttA	3108397..3108445	-14.9	AAAAA<left>GCUCCAGA</left>AUG<right>UCUGGAGC</right>UUUUUCUGUUUCACA	Northern blotting (0.7 kb transcript); upstream and downstream genes are on the opposite strand	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220	bidirectional terminator
ytsD	ytsD	3108408..3108451	-14.9	AAAAA<left>GCUCCAGA</left>CAU<right>UCUGGAGC</right>UUUUUGUUUAUCGUU	proposed; downstream gene is on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220	bidirectional terminator
ytrA,ytrB,ytrC,ytrD,ytrE,ytrF	ytrABCDEF	3112991..3113044	-16.8	AACGA<left>GCCGGCUG</left>AGA<right>CAGCCGGC</right>UUUUUCUAUAGCGCA	Northern blotting (5.5 kb transcript)	10986249 (Yoshida et al., J. Bacteriol. 2000, 182(19):5454-5461); 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytpB	ytpB	3120572..3120622	-12.7	AAAAA<left>GCUCAAAUCA</left>UUUGC<right>UGAUCUGAGC</right>UUUUUUUUCGAUGGC	proposed; downstream genes are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143:3431-3441); Genbank AF008220
asnB,ytnA	asnB-ytnA	3123267..3123311	-9.4	AAAAA<left>GAGCUC</left>CCAGU<right>GGGCUC</right>UUUUUGUGUGUGCUC	Northern blotting (3.8 kb transcript)	10498721 (Yoshida et al., J. Bacteriol. 1999, 181(19):6081-6091); Genbank AF008220	The Northern blotting results did not give conclusive evidence that asnB and ytnA belong to the same operon. Genbank entry AF008220 also suggests the existence of a terminator between asnB and ytnA at position 3124721..3124778 (GTACGGAATATTC<left>AGAAAAA</left>TGATATAATGATATT<right>TTTTTCT</right>AGGGGAGAAGAAGCAT)
metK	metK	3126834..3126875	-14.3	UUAUA<left>GCCGCUUA</left>CUGGU<right>UAAGCGGC</right>UUUCCCUUUUUUAUC	proposed	9387221 (Lapidus et al., Microbiology 1997, 143:3431-3441); Genbank AF008220
pckA	pckA	3130150..3130202	-19.4	CAAAA<left>GCCAAGAGCA</left>AUUA<right>UGCUCUUGGC</right>UUGUUUUAAUUGACG	proposed; upstream and downstream genes are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143:3431-3441); Genbank AF008220	bidirectional terminator
ytmB	ytmB	3130161..3130215	-19.3	AACAA<left>GCCAAGAGCA</left>UAAU<right>UGCUCUUGGC</right>UUUUGUUUUUUAUAC	proposed; downstream gene is on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143:3431-3441); Genbank AF008220	bidirectional terminator
ytlD	ytlD	3133973..3134035	-14.6	AAAAA<left>CCCGGCA</left>CAUG<right>UGCCGGG</right>UUUUUUAUUCAAUCC	proposed	9387221 (Lapidus et al., Microbiology 1997, 143:3431-3441)	bidirectional terminator
ytkD	ytkD	3133999..3134046	-14.6	AAAAA<left>CCCGGCA</left>CAUG<right>UGCCGGG</right>UUUUUUAUGUCCUCC	proposed	9387221 (Lapidus et al., Microbiology 1997, 143:3431-3441)	bidirectional terminator
dps	dps	3135234..3135290	-22.4	GAACG<left>GCCGGAUGUCUU</left>AAAA<right>AAGACGUCCGGC</right>UUUUCUUUUUGUAUC	Northern blotting (0.5 kb transcript)	9393687 (Antelmann et al., J. Bacteriol. 1997, 179(23):7251-7256); 9387221 (Lapidus et al., Microbiology 1997, 143(11):3431-3441); SubtiList	A 1.2 kb transcript was also detected, which may have been a ytkA-dps transcript. SubtiList shows an additional terminator TCTTA<left>AAAAAGACGT</left>CCG<right>GCTTTTCTTTTT</right>GTATCTG at position 3135225..3135261 (dG = -6.2 kcal/mole), which contains three consecutive mismatched bases.
luxS	luxS	3136497..3136553	-18.8	GAAAG<left>GACCUUUUUGC</left>GCUUAA<right>GCAAAAAGGUC</right>UUUUUUGUGACGUCU	roposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ythC	ythC	3141086..3141144	-9.9	AGAAA<left>GAGCUGC</left>AUCA<right>GCCAGCUC</right>UUUCUUUUUGCAUGU	proposed; downstream genes are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220	bidirectional terminator
mntA,mntB,mntC,mntD	mntABCD	3141106..3141158	-9.6	AGAAA<left>GAGCUGGC</left>UGAU<right>GCAGCUC</right>UUUCUUUUAAUUAUA	Northern blotting (4.0 kb transcript)	10760146 (Que & Helmann, Mol. Microbiol. 2000, 35(6):1454-1468); 15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107)	bidirectional terminator
menF,menD,ytxM,menB,menE,menC	menBEC	3145172..3145222	-13.4	UUGGA<left>CCGGCUG</left>CUGACC<right>CAGCCGG</right>UUUUUUUAUGUAAAU	proposed	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); 1629163 (Driscoll & Taber, J. Bacteriol. 1992, 174(15):5063-5071); 3131310 (Miller et al., J. Bacteriol. 1988, 170(6):2742-2748); Genbank AF008220	Readthrough terminator TCAGCAATATCTAGTAAACC<left>AACAGCTTGAGACT</left>TTGC<right>GGTCCAAGCTGTT</right>TTCTTTTCAATACAGACATTTT at position 3147876..3147948 was found by RNA protection assays downstream of menB. Internal promoter in front of menB and menE. An S1 nuclease experiment of the 5' end showed that menF and menD belong to the same operon. RNase protection assays showed that transcription of menB occurs from an upstream region in addition to the menB promoter, indicating that either no terminator or a readthrough terminator exists downstream of ytxM. Genbank AF008220 lists the terminator GCATGGTTAAG<left>AAAAAAGC</left>ATTTT<right>GCTATTTT</right>GAATAAATGA (dG = -7.8 kcal/mole) at position 3145254..3145295 instead of the indicated terminator; SubtiList shows both.
yteA	yteA	3153755..3153803	-12.9	UUGAA<left>CCCCCAA</left>UUA<right>UUGGGGG</right>UUCUUUUCCGUUUUC	proposed; upstream and downstream gene are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
cotSA,cotS,ytxO	cotSA-cotS-ytxO	3158283..3158321	-11.2	CGCAA<left>GGCAUAAA</left>GUCACA<right>UUUAUGCC</right>UUUUUUUAAGUUCUC	Northern blotting (2.7 kb transcript)	9603889 (Takamatsu et al., J. Bacteriol. 1998, 180(11):2968-2974); 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytaB	ytaB	3162749..3162787	-11.7	AAAAA<left>GCCGCU</left>UAUAC<right>AGCGGC</right>UUUUUCACAUCAUCG	proposed; downstream genes are on the opposite strand	9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220	bidirectional terminator
glgB,glgC,glgD,glgA,glgP	glgBCDAP	3162751..3162797	-13.0	AAAAA<left>GCCGCU</left>GUAUA<right>AGCGGC</right>UUUUUUUGUUCACAG	proposed	3162832 (Kiel et al., Mol. Microbiol. 1994, 11(1):203-218)	bidirectional terminator
rrnB-16S,rrnB-23S,rrnB-5S,trnB-Val,trnB-Thr,trnB-Lys,trnB-Leu1,trnB-Gly1,trnB-Leu2,trnB-Arg,trnB-Pro,trnB-Ala,trnB-Met1,trnB-Met3,trnB-Ser1,trnB-Met2,trnB-Asp,trnB-Phe,trnB-His,trnB-Gly2,trnB-Ile2,trnB-Asn,trnB-Ser2,trnB-Glu	rrnB-16S-rrnB-23S-rrnB-5S-trnB-Val-trnB-Thr-trnB-Lys-trnB-Leu1-trnB-Gly1-trnB-Leu2-trnB-Arg-trnB-Pro-trnB-Ala-trnB-Met1-trnB-Met3-trnB-Ser1-trnB-Met2-trnB-Asp-trnB-Phe-trnB-His-trnB-Gly2-trnB-Ile2-trnB-Asn-trnB-Ser2-trnB-Glu	3170887..3170926	-11.2	AGAAG<left>CCUUGCA</left>UAUCC<right>UGCAAGG</right>UUUUUUUGUUUUUAU	proposed	2414156 (Green et al., Gene, 1985, 37(1-3):261-266)	another putative terminator is TTTCTTCAGAAAATGAAGTTAATTGTCTATAAGTATA<left>AGCGCTTTC</left>AG<right>GAAAGGGCT</right>TTTTTTTATTTCTTCGAAT at 3170768..3170843
yuaF,yuaG,yuaI	yuaFGI	3178923..3178976	-23.8	AAAAA<left>UCCCCCAGCGG</left>AAU<right>UCGCUGGGGGA</right>UUGUUACUUUUACGC	proposed	9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371); SubtiList
yulF	yulF	3196919..3196973	-21.0	AAAAA<left>UCCGCCCGCGUGC</left>AAAU<right>GCCGCGGCGGA</right>UUUUUUAUUAGACAA	proposed; upstream and downstream genes are on the opposite strand	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93938
tlpB	tlpB	3203065..3203122	-9.8	AGAAA<left>GCGGCA</left>UAUC<right>UGCUGC</right>UUUCUUUUUUUGUUA	proposed	8188684 (Hanlon & Ordal, J. Biol. Chem. 1994, 269(19):14038-14046)
tlpA,mcpA	tlpA-mcpA	3205166..3205214	-17.6	CUUAA<left>CACCCAAGC</left>UUGUUGC<right>GCUUGGGUG</right>UUUUUUUUAGUUUUU	proposed	8188684 (Hanlon & Ordal, J. Biol. Chem. 1994, 269(19):14038-14046)	internal promoter suspected (but not shown experimentally) in front of mcpA
mcpB	mcpB	3209445..3209490	-13.3	AAAAA<left>CAGCGCU</left>AUCAA<right>AGCGCUG</right>UUUUUUUAUAUGGUA	proposed	8188684 (Hanlon & Ordal, J. Biol. Chem. 1994, 269(19):14038-14046)
tgl	tgl	3212358..3212425	-20.6	CAUCGUCCGCUAAAAA<left>GCCCCAUCGCC</left>UAUUUUCC<right>GGACGAUGGGGU</right>UUCAAAUGCCUUUCG	proposed; upstream and downstream genes are on the opposite strand	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93935
yugT	yugT	3213378..3213413	-9.1	CUAAA<left>CUCCAG</left>CCUUAGA<right>CUGGAG</right>UUUUUUUGUUUUAUC	proposed	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93935
yugS	yugS	3215163..3215214	-11.4	AAAAA<left>CAGCCG</left>GGGAACAAA<right>CGGCUG</right>UUUUUUGUGUCAUCA	proposed	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93935
pgi,yugM,yugN	pgi-yugMN	3218798..3218850	-15.0	UAAGA<left>GGAGGGG</left>AAAGCAUCGG<right>CCCCUCC</right>UUUUUUUGUAUGCCU	Northern blotting (2.4 kb transcript)	11489127 (Ludwig et al., Mol. Microbiol. 2001, 41(2):409-422); Genbank Z93936	A readthrough terminator AAAAACGTCTGGAAGATTAATGTGAG<left>AAAGCTGACTGGCA</left>TT<right>TGCCGGTCGGCTTT</right>TTATAAAATCAGAAA exists at position 3219718..3219788 downstream of pgi, leading to a 1.5 kb transcript. Genbank Z93936 lists another potential terminator ATGGCTGTTTACTTCTTAATTGAATGCGC<left>TTTCTTTC</left>CTGTTGGCCGCGC<right>GAAAGAAA</right>CAACGATTTCCATGTAGGCGC at position 3219335..3219413 inside the yugM gene, and AAACAACGATTTCCATGTAGGCG<left>CCTCTGAA</left>TGAAGTCTTG<right>TTCGGCGG</right>GACAGGATAAGTGAAAAA at position 3219292..3219358 downstream of yugM.
yugK	yugK	3221191..3221244	-17.3	CCAAA<left>GGGCGGAAU</left>CCAGUC<right>AUUCCGCCC</right>UUUCUUCUUGACUUG	proposed	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93934
yugJ	yugJ	3222468..3222523	-17.2	AAAAG<left>GGGAAAUAGCC</left>GUUU<right>GGCUGCUUCCC</right>UUUUUCUUUUUUGUC	proposed	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93934
yugI	yugI	3224175..3224228	-20.4	AAAAA<left>GCACCGGACA</left>GGAA<right>UGUUCGGUGC</right>UUUUGAUUUCAUGCA	proposed	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93934
yugF	yugF	3227434..3227473	-9.4	AAAAA<left>CCGGU</left>GCUGA<right>ACCGG</right>UUUUUUUAAGGCGUG	proposed; upstream and downstream gene are on the opposite strand	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93934	bidirectional terminator
yugE	yugE	3227442..3227487	-8.1	AAAAA<left>CCGGU</left>UCAGC<right>ACCGG</right>UUUUUUUGUUAUUUG	proposed; upstream and downstream gene are on the opposite strand	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93934	bidirectional terminator
patB	patB	3228980..3229032	-15.1	GUAAA<left>CGCCUUUACG</left>UCUUCAUU<right>UGUAAAGGCG</right>UUCUUAAUAAAGGAA	proposed	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93933
kinB,kapB	kinB-kapB	3230808..3230857	-13.0	CAUAA<left>CCCAGUCU</left>GACAAA<right>AGAUUGGG</right>UUUUUUACGUCGCGC	proposed	8497199 (Trach & Hoch, Mol. Microbiol. 1993, 8(1):69-79)
pbpD,yuxK	pbpD-yuxK	3235295..3235346	-14.6	CAAAA<left>UCCUAAAACG</left>GCUU<right>CGUUUUAGGA</right>UUUUGUCAUCUAUUC	proposed	7961491 (Popham & Setlow, J. Bacteriol. 1994, 176(23):7197-7205); Genbank Z93933
yufM	yufM	3238483..3238541	-19.6	GAAAA<left>CGCACUGCUU</left>GCUUU<right>GAGCAGUGCG</right>UUUUUCUGUCAUAUC	proposed	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93937
yufN	yufN	3240041..3240100	-16.9	AUCGC<left>AGGGAUAAGG</left>AGGUCGAGC<right>CCUUAUCCCU</right>UGUUUUUCUUUUAUUUU	Northern blotting (1.4 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); SubtiList
maeN	maeN	3245145..3245201	-15.8	AGAAA<left>GAGUUCCGU</left>UUUAU<right>GCGGAACUC</right>UUUUUUUAUUUAUUC	Northern blotting (1.35 kb transcript); downstream genes are on the opposite strand	12949159 (Tanaka et al., Microbiology 2003, 149(Pt.9):2317-2329)	synonym: yufR
mrpA,mrpB,mrpC,mrpD,mrpE,mrpF,mrpG	mrpABCDEFG	3251403..3251454	-15.2	AUAAG<left>CAGCCGGA</left>CAGGCAGAGU<right>UCCGGCUG</right>UUUUUUUAUUUCUUG	Northern blotting (5.9 kb transcript); downstream genes are on the opposite strand	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); 10198001 (Ito et al., J. Bacteriol. 1999, 181(8):2394-2402); Genbank Z93932	bidirectional terminator
comA,yuxO	comA-yuxO	3251407..3251455	-17.2	AAAAA<left>CAGCCGGA</left>ACUCUGCCUG<right>UCCGGCUG</right>CUUAUUUUUAUAAAUA	S1 nuclease mapping	2507522 (Guillen et al., J. Bacteriol. 171(10), 5354-5361, 1989); 2507523 (Weinrauch et al., J. Bacteriol. 1989, 171(10):5362-5375)	Bidirectional terminator. S1 nuclease mapping showed that termination occurs in the TTATTTT stretch.
comP	comP	3252526..3252575	-15.4	GAAAC<left>GACUUGGC</left>ACAG<right>GCCAAGUC</right>UUUUUUAUAAAAUGG	proposed	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93932
comQ,comX	comQX	3254883..3254928	-7.0	AAUA<left>ACCC</left>GUCAAUG<right>GGGU</right>GAUUAAUAGGUGGAUUA	S1 nuclease mapping	1715859 (Weinrauch et al., J. Bacteriol. 173(18): 5686-5693, 1991)	S1 nuclease mapping estimated that transcription ends about 30 base pairs downstream of the indicated stem-loop. As the stem-loop is not followed by a T-stretch, the mapped transcript end may actually be due to an RNA processing event. The indicated stem-loop overlaps the comX gene, which was unknown at that time. The downstream gene comP is separated by 14 base pairs from comX, suggesting that comP also belongs to this operon.
degQ	degQ	3256104..3256147	-10.4	AAAAA<left>GACUUG</left>GAAA<right>CAAGUC</right>UUUUUUUUCGUUCUA	proposed	3007431 (Yang et al., J. Bacteriol. 166(1): 113-119, 1986)
yuzC	yuzC	ND	ND	ND	upstream and downstream genes are in the opposite direction	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972); Genbank AF008220	The 3' ends of the yuzC and the converging yuxH coding regions overlap. A terminator for yuxH was found experimentally downstream of yuzC.
yuxH	yuxH	3256633..3256685	-9.6	GAAAA<left>GGCCACAAC</left>UUUAGC<right>GUUGCGGUC</right>UUUUUCGGUGUUUGU	S1 nuclease mapping	2507522 (Guillen et al., J. Bacteriol. 171(10), 5354-5361, 1989); 2507523 (Weinrauch et al., J. Bacteriol. 171(10): 5362-5375, 1989)	The 3' ends of the yuxH and the converging yuzC coding regions overlap. The terminator that was found experimentally for yuxH is downstream of yuzC, upstream of degQ. The low-resolution S1 nuclease mapping estimated the termination signal to be about 30 base pairs downstream of the indicated stem-loop.
yueK	yueK	3258406..3258460	-19.5	AAAAA<left>CUGGCCUUUC</left>AUUCGC<right>GAAGGGCCAG</right>UUUUCUUUAUGUAUA	proposed	9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93932
yukF	yukF	ND	ND	ND	ND	8226620 (Siranosian et al., J. Bacteriol. 175(21) 6789-6796, 1993)	The putative terminator CGGCA<left>CATGGATTTGTGA</left>AATT<right>TCACAAATCCATG</right>TTTTTTTATTTTCTT (dG = -21.2 kcal/mole) at position 3277234..3277263 is inside the yukF coding region.
ald	ald	3278478..3278532	-14.8	AUAAG<left>CUUGCAGAA</left>AGAU<right>UUCUGCAGG</right>ACUUUUUUAUUUUUUAA	integrational mapping	8226620 (Siranosian et al., J. Bacteriol. 175(21) 6789-6796, 1993)
dhbA,dhbC,dhbE,dhbB,dhbF	dhbACEBF	3279279..3279328	-15.4	AAAAA<left>GAGACUGC</left>UUGCC<right>GCAGUCUC</right>UUUUUCUAUCUUACG	operon disruption	8921902 (Rowland et al., Gene 178(1-2):119-123, 1996)	operon disruption showed that at least the first four genes belong to the same operon
yuiI	yuiI	3291428..3291486	-16.4	ACUGA<left>AAUUAUAUUUGACUGUC</left>ACAU<right>GACAUUUGGAUAUGAUU</right>AUUUUUAUAAUUGAUA	proposed	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629)
guaC	guaC	3303043..3303097	-20.9	AAAAA<left>CGCCAAGUCAGCGG</left>UUCU<right>CCGCUUGAGUUGGCG</right>UUUUCUGCUACUUCU	upstream and downstream genes are on the opposite strand	Genbank Z93939
yunB	yunB	3321456..3321514	-15.3	AAUAA<left>GCCGCCU</left>GUUGAAG<right>AGGCGGC</right>UUUUUGUUACUUCUU	downstream gene is in the opposite direction	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)
pucH	pucH	3326239..3326287	-18.2	GUAAG<left>CCCGGCGG</left>AUUUUA<right>CCGCCGGG</right>UUUUUUGAUUUCCUC	proposed	12029039 (Beier et al., J. Bacteriol. 2002, 184(12):3232-3241); SubtiList
pucR,pucJ,pucK,pucL,pucM	pucRJKLM	3334000..3334055	-17.4	AGGAA<left>GCCCGCC</left>UCACC<right>GGCGGGC</right>UUCUUUUUGCACUUC	Northern blotting (6.2 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)	Internal promoter in front of pucJ, leading to a 4.6 kb transcript. Note that Beier (12029039) incorrectly assumed that pucR is transcribed monocistronically
pucA,pucB,pucC,pucD,pucE	pucABCDE	3334762..3334803	-16.7	CGGGA<left>GUCCGGCUU</left>UUAA<right>AAGCCGGAC</right>UUUUUUAGCCUCAGU	Northern blotting (5.3 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
yurH,yurG	yurHG	3340149..3340196	-15.4	GAAAA<left>GCUUGCGG</left>AACU<right>CCGCAAGC</right>UUUUUAACGAUAUGA	proposed	12029039 (Beier et al., J. Bacteriol. 2002, 184(12):3232-3241); SubtiList	Synonym: pucFG
yurR,yurQ,yurP,yurO,yurN,yurM,yurL	yurRQPONML	3346061..3346111	-9.3	AAAAA<left>CGAGAAUACU</left>AUAAGC<right>AGUGUCUCG</right>UUUUUUAUGCCUGUU	Northern blotting (7.5 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)	The long mRNA molecule agrees poorly with the sequence and with the microarray data. The Northern blotting results also showed yurP (1.0 kb) and yurPO (2.5 kb) transcripts.
sspG,yurS	sspG-yurS	3353507..3353549	-15.2	AAAAA<left>CCGCGGCC</left>CCUC<right>GGCCAGCGG</right>UUUUUCUUCUGCAUA	primer extension analysis of the downstream yurS gene; genes further downstream are on the opposite strand	9852018 (Bagyan et al., J. Bacteriol. 1998, 180(24):6704-6712); SubtiList
yusV	yusV	3378081..3378146	-25.4	TAACG<left>CAGCGAAGGAGCTTTC</left>AATTGA<right>GAAAGCTCCTTGCTG</right>TTTTTTCGAAAGGAA	proposed	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); SubtiList	Terminator partially overlaps the downstream yusU gene.
mrgA	mrgA	3383050..3383098	-17.0	AAAAA<left>GCUGAACCU</left>UAAUC<right>GGGUUCAGC</right>UUUUUGUUUUUUCUU	downstream genes are on the opposite strand	8396117 (Chen et al., J. Bacteriol. 1993, 175(17):5428-5437); SubtiList
yvtA	yvtA	3383052..3383104	-14.0	AAAAA<left>GCUGAACC</left>CGAUUAA<right>GGUUCAGC</right>UUUUUUGUUACCCUA	upstream and downstream genes are on the opposite strand	ND	synonym for htrB
cssR,cssS	cssRS	3386767..3386809	-14.0	CAAAA<left>UAGACUGUAGA</left>UGU<right>UUUGCAGUCUA</right>UUUUUUUAUGUGAAA	proposed	11555295 (Hyyrylainen et al., Mol. Microbiol. 2001, 41(5):1159-1172)
citG	citG	3388000..3388053	-16.9	AAGAA<left>CGGCUGCUU</left>UUU<right>AAGCAGCCG</right>UUCUUCUAAAUAUGU	upstream and downstream genes are in the opposite direction	3923430 (Miles & Guest, Nucleic Acids Res. 1985, 13(1):131-140)
gerAA,gerAB,gerAC	gerAABC	ND	ND	ND	transcriptional fusions; upstream and downstream genes are in the opposite direction	3110007 (Zuberi et al., Gene 1987, 51(1):1-11)
yvrE	yvrE	3404651..3404708	-15.1	AAAAA<left>CGCAUCCG</left>AAACA<right>CGGAUGCG</right>UUUUUUUAUACUACA	ND	ND
yvrP	yvrP	ND	ND	ND	ND	ND	ND
fhuD	fhuD	3418644..3418703	-14.8	CAAAA<left>GAGCCGC</left>CUGCCC<right>GCGGCUC</right>UUUUGCUUAUUUAUA	ND	ND
sspJ	sspJ	ND	ND	ND	proposed	9852018 (Bagyan et al., J. Bacteriol. 1998, 180(24):6704-6712)	The stem-loop identified by Bagyan et al. lacks a T-stretch.
yvgO	yvgO	3427301..3427356	-14.3	AAAAA<left>GCUGGCG</left>CUCUAA<right>CGCCAGC</right>UUUUUUUCUGCAUUU	ND	ND
yvgR,yvgQ	yvgRQ	3429583..3429630	-18.1	GACGA<left>GAGACAGGGAG</left>UAG<right>CUUCCUGUCUC</right>UUUUUUCUAUAAUUU	reverse transcription PCR	12169591 (Guillouard et al., J. Bacteriol. 2002, 184(17):4681-4689); SubtiList	synonym: cysJI
bdbD,bdbC	bdbDC	3436634..3436687	-16.4	AAAAA<left>GCGCCCGC</left>GUAU<right>GCCGGGCGC</right>UUUUUUAAUUUCGCA	proposed	11744713 (Meima et al., J. Biol. Chem. 2002, 277(9):6994-7001)
opuBA,opuBB,opuBC,opuBD	opuBABCD	3458797..3458836	-15.4	AAAAA<left>GAGGCUGG</left>AGU<right>CCAGCCUC</right>UUUUUUCUCUUUAAA	proposed	10216873 (Kappes et al., Mol. Microbiol. 1999, 32(1):203-216)
cggR,gapA,pgk,tpiA,pgm,eno	cggR-gapA-pgk-tpiA-pgm-eno	3475546..3475596	-19.1	AAAGA<left>CCGCCGGGA</left>UUUUC<right>UCUCGGCGG</right>CUUUUUUAUGCUUUCA	Northern blotting (7.4 kb transcript)	11489127 (Ludwig et al., Mol. Microbiol. 2001, 41(2):409-422); Genbank L29475; SubtiList	A readthrough terminator AGCGCTATAATGAAAGCGGAC<left>AAGGGAAGGGGA</left>CGGAC<right>TCCCTTTCCCTT</right>TTTCCATGAAGACCGGCTTTCAG was found at position 3480614..3480686 downstream of gapA, leading to a 2.2 kb cggR-gapA transcript and a 6.2 kb gapA-pgk-tpiA-pgm-eno transcript. Internal promoters in front of gapA and pgk, leading to a 1.2 kb monocistronic gapA transcript and a 4.8 kb pgk-tpiA-pgm-eno transcript.
araE	araE	3483056..3483103	-19.8	UGAAA<left>CAGCCCUUUC</left>UACG<right>GGAAGGGCUG</right>UUUAUAUUGGGAUGC	Northern blotting (1.7 kb transcript)	9401028 (Sa-Nogueira & Ramos, J. Bacteriol. 1997, 179(24):7705-7711); Genbank Y12105
araR	araR	3485773..3485830	-15.7	AAAAA<left>GCAAUGUAUGGG</left>UCUC<right>CCCGCUACAUUGC</right>UUUUUUUAUAGCUGU	Northern blotting (1.4 kb transcript)	9045819 (Sa-Nogueira & Mota, J. Bacteriol. 1997, 179(5):1598-1608); Genbank X98354
yvfK,yvfL,yvfM,lacA,yvfO	yvfKLM-lacA-yvfO	3500628..3500691	-27.2	AAAAA<left>AUCCAUGAGAUGUAACAA</left>AUCA<right>UUGUUAUGUCUCAUGGAU</right>CAUUUUAUUUUACAUCA	proposed	9287030 (Daniel et al., J. Bacteriol. 1997, 179(17):5636-5638)
yvfG	yvfG	3513126..3513176	-18.0	AUAAA<left>CCUUCCGCUCA</left>CAUG<right>UGAGCAGGAAGG</right>UUUUCCUUCUUUGAG	Northern blotting (0.24 kb transcript)	15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107); Genbank Z71928
yveK,yveL	yveKL	ND	ND	ND	Northern blotting (1.2 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
pbpE,racX	pbpE-racX	3532407..3532462	-17.0	UCAGA<left>CAAGGACUGU</left>CUUCAA<right>ACAGUCCUUG</right>UUUUUUUAUGUUCCU	mutational analysis	8491712 (Popham & Setlow, J. Bacteriol. 1993, 175(10):2917-2925)
sacB,yveB,yveA	sacB-yveBA	3539741..3539791	-14.8	AUAAA<left>GAAGCAAGA</left>GGUUU<right>UCUUGCUUC</right>UUUAUUCUUUACAAA	Northern blotting (4.9 kb transcript)	11739774 (Pereira et al., Microbiology 2001, 147(Pt.12):3413-3419)	the readthrough terminators AAACGC<left>AAAAGAAAATGCC</left>GATATCCTATT<right>GGCATTTTCTTTT</right>ATTTCTTATC at 3536464..3536516 and TGAAT<left>AAAAACAGGGGC</left>GGCGCAGGCT<right>GCCCCTGTTTTT</right>TTATTAGGAGC at 3538081..3538130 were found downstream of sacB and yveB respectively, leading to a 1.7 kb monocistronic sacB transcript and a 3.3 kb sacB-yveB transcript.
clpP	clpP	3545855..3545903	-17.7	CACAA<left>CCUGCAAGAGC</left>UGC<right>GUCUCUUGCAGG</right>UUUUUUUCAUUUCAA	Northern blotting (0.8 kb transcript)	8973311 (Gerth et al., Gene 1996, 181(1-2):77-83); 9643546 (Gerth et al., Mol. Microbiol. 1998, 28(4):787-802)	mRNA length not quite consistent with terminator position
yvlA,yvlB,yvlC,yvlD	yvlABCD	3605759..3605811	-11.9	AAAAA<left>GCUGCC</left>CGCAAA<right>GGCAGC</right>UUUUUUACAUGUGGU	proposed	9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371); Sonenshein
yvzB	yvzB	3608368..3608425	-24.2	UUACA<left>GCUUGCCGACAGAGUCCA</left>UUAAC<right>UGGAUGUGCCGGCAGGC</right>UUUUUUUGUUACAAU	Northern blotting (approximately 1.0 kb transcript)	15033535 (Serizawa et al., Gene 2004, 329:125-136)
uvrB,uvrA	uvrBA	3609030..3609084	-23.2	GGACA<left>GCUUGUCGGCAAGUCCA</left>UCCU<right>UGGGCUUAGCAGGCAAGC</right>UUUUUCUUUACGGCA	proposed	SubtiList
csbA	csbA	3614083..3614137	-14.9	GAAUA<left>CCUGCUUUUA</left>CGUUU<right>UAAAAGCAGG</right>UUUUUUAUACACAAA	terminator-probe plasmids	1744042 (Boylan et al., J. Bacteriol. 1991, 173(24):7856-7866)
yvyD	yvyD	3629990..3630052	-15.7	AGAAG<left>CCUUCCGUG</left>AUGUC<right>CGCGGAAGG</right>UUUUUGUUUUUCUUA	Northern blotting (0.6 kb transcript)	9852014 (Drzewiecki et al., J. Bacteriol. 1998, 180(24):6674-6680); 8195064 (Chen & Helmann, J. Bacteriol. 1994, 176(11):3093-3101)
yvyC,fliD,fliS,fliT	yvyC-fliDST	3631015..3631057	-21.5	AACAG<left>AAGGGGAUCGGAUCU</left>ACCA<right>AGAUCUGAUCCAAGCCUU</right>UUUUUAUUUGGAUUC	proposed	8195064 (Chen & Helmann, J. Bacteriol. 1994, 176(11):3093-3101)
hag	hag	3633977..3634018	-16.9	AAAAA<left>GACCUUGGC</left>GUU<right>GCCAGGGUC</right>UUUUAAUUUAAAUUU	Northern blotting (1.0 kb transcript)	2498284 (Mirel & Chamberlin, J. Bacteriol. 1989, 171(6):3095-3101)
csrA	csrA	3635061..3635106	-12.4	CAUUA<left>UCCUCAC</left>AAAAAAA<right>GUGAGGA</right>UUUUUUUAUUUUUGU	proposed	8969505 (Soldo et al., Microbiology 1996, 142(Pt.11):3079-3088); Genbank U56901
yvyF,flgM,yvyG,flgK,flgL	yvyF-flgM-yvyG-flgKL	3636340..3636389	-8.1	AGUAA<left>GCGGCUC</left>UUAG<right>GAGUUCGC</right>UUUUUUUAUAGUUCA	proposed	8969505 (Soldo et al., Microbiology 1996, 142(Pt.11):3079-3088); 8045879 (Mirel et al., J. Bacteriol. 1994, 176(15):4492-4500)	Soldo et al. suggest that the stem-loop structure may be an mRNA stabilizer rather than a terminator. In that case, the operon would also contain the genes yviE, yviF, and csrA. Serizawa et al. (Gene, 329:125-136, 2004) show that yviE-yviF, like the yvyF operon, are SigD-dependent.
comFA,comFB,comFC	comFABC	3640139..3640166	-4.6	UUGAU<left>CAGAA</left>GCUAAAUGA<right>UUCUG</right>UUUUUAUGCCGAUAU	proposed	8412657 (Londono-Vallejo et al., Mol. Microbiol. 9(1): 119-131, 1993)
yviA	yviA	3642654..3642706	-13.5	CCAAA<left>UCUCCGUUU</left>UUA<right>GAGCGGAGA</right>UUUUUUUAUAUUCUU	proposed	8412657 (Londono-Vallejo et al., Mol. Microbiol. 9(1): 119-131, 1993)
degS,degU	degSU	3643596..3643644	-15.5	UAGGA<left>GACUUGCCU</left>UUUACU<right>AGGCAGGUC</right>UUUUUUUAGGCUGCC	lacZ fusions	1688843 (Msadek et al., J. Bacteriol. 172(2): 824-834, 1990); 8969505 (Soldo et al., Microbiology 1996, 142(Pt.11):3079-3088); Genbank U56901	The terminator downstream of degU suggests that the downstream yviA gene does not belong to this operon.
yvhJ	yvhJ	3647601..3647666	-22.9	AAAAA<left>UGCCCGGUCCUU</left>UUA<right>GAGGAUCGGGCA</right>UUUUUGCGCAGAAAA	proposed; downstream genes are on the opposite strand	8969505 (Soldo et al., Microbiology 1996, 142(Pt.11):3079-3088); Genbank U56901	SubtiList also shows the terminator GCGCAGAA<left>AAAAACTCCGGC</left>ACATAA<right>GCCGGAGTTTTT</right>AATTCCTTTTCACCAGCCGTTTATA (dG = -22.5 kcal/mole) at position 3647648..3647710.
tuaA,tuaB,tuaC,tuaD,tuaE,tuaF,tuaG,tuaH	tuaABCDEFGH	3648878..3648934	-14.6	AACAU<left>GCGUAGUCCUA</left>UAAAU<right>UGGGAUGCGC</right>GUUUUUUGAUUAUACG	Northern blotting (9.0 kb transcript); transcriptional fusions to tuaD and tuaH	10627039 (Lahooti & Harwood, Microbiology 1999, 145(Pt.12):3409-3417); 10048024 (Soldo et al., Mol. Microbiol. 1999, 31(3):795-805); Genbank AF015609	several smaller mRNA molecules were also detected; these may be prematurely terminated transcripts or processed products.
lytA,lytB,lytC	lytABC	3658110..3658159	-16.7	CGAAA<left>GAGACAAAUCU</left>AAUCAC<right>AGAUUUGUCUC</right>UUUUUUAUAUGAAAU	Northern blotting (4.1 kb transcript)	1357079 (Lazarevic et al., J. Gen. Microbiol. 1992, 138(Pt.9):1949-1961); 8093697 (Kuroda & Sekiguchi, J. Bacteriol. 1993, 175(3):795-801)	Shorter transcripts were also detected.
lytR	lytR	3663219..3663275	-16.6	AAAAA<left>GAAGCUUCGCAC</left>AAU<right>GUGCAAAGCUUC</right>UUUUUUAUUUGCCUG	proposed	1357079 (Lazarevic et al., J. Gen. Microbiol. 1992, 138(Pt.9):1949-1961)
gtaB	gtaB	3665527..3665581	-17.2	AAAAA<left>GGCUAUUGGA</left>CAUUCA<right>UCCAAUAGCC</right>UUUUUUUAUUUCAAC	proposed	8320212 (Varon et al., J. Bacteriol. 1993, 175(13):3964-3971)
tagD,tagE,tagF	tagDEF	3675135..3675166	-15.0	UGUAU<left>AGCUGUCGA</left>UUUU<right>UCGGCAGCU</right>UUUUAGAUACUUGUU	proposed	2507871 (Honeyman & Stewart, Mol. Microbiol. 1989, 3(9):1257-1268)	Honeyman & Stewart propose that the ATTTTATAAAAT inverted repeat in front of the terminator hairpin functions to slow the RNA polymerase prior to transcription termination. See also 94251 (Rosenberg & Court, Annu. Rev. Genet. 1979, 13:319-353). 
tagA,tagB	tagAB	3682337..3682388	-17.5	AUGAU<left>GACACUUGUUC</left>AAAACA<right>GAACAAGUGUU</right>CUUUUUUCUAUUGAAU	proposed	7952180 (Mauel et al., Microbiology 1994, 140(Pt.9):2279-2288); SubtiList	integrational plasmids showed that tagC does not belong to the proposed tabAB operon
tagC	tagC	3683794..3683846	-24.7	UCAAA<left>UAGGCUGUAGCUAU</left>UUA<right>AUAGCUACAGCCUA</right>UUUGCAACUUUCUAA	proposed	7934877 (Margot et al., Mol. Microbiol. 1994, 12(4):535-545)	bidirectional terminator
lytD	lytD	3683798..3683851	-24.7	GCAAA<left>UAGGCUGUAGCUAU</left>UAA<right>AUAGCUACAGCCUA</right>UUUGAUUAUCACACC	proposed	7934877 (Margot et al., Mol. Microbiol. 1994, 12(4):535-545)	bidirectional terminator
pmi	pmi	3686596..3686640	-11.5	UUAAA<left>CUUAAUCUC</left>ACUUC<right>GAGGUUAAG</right>UUUUUUUAUUAGAAA	proposed	7934877 (Margot et al., Mol. Microbiol. 1994, 12(4):535-545)
gerBA,gerBB,gerBC	gerBABC	3691525..3691566	-19.0	CAAAA<left>GGGUGCGC</left>AUGAUC<right>GCGCACCC</right>UUUUUUAUGUUCCGA	transcriptional integrations; upstream and downstream genes are transcribed in the opposite direction	8012571 (Corfe et al., Microbiology 1994, 140(Pt.3):471-478); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92954	bidirectional terminator
ywtG	ywtG	3691522..3691563	-18.9	AAAAA<left>GGGUGCGC</left>GAUCAU<right>GCGCACCC</right>UUUUGAUUGCUUACU	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92954	bidirectional terminator
ywtF	ywtF	3694230..3694278	-21.1	AUGAA<left>CGGGAUGGCG</left>AUUA<right>CGCCAUCCCG</right>UUUUACAUAUUUCCU	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92954
ywtD	ywtD	3695250..3695298	-12.4	AAAAA<left>GACUCCA</left>AUCUC<right>UGGAGUC</right>UUUUCUUUAUGCAUA	proposed	15033535 (Serizawa et al., Gene 2004, 329:125-136); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92954
ywsC,ywtA,ywtB,ywtC	ywsC-ywtABC	3696624..3696682	-18.0	AAAAA<left>GAGAGUGUCU</left>GAUG<right>AGACACUCUC</right>UUUUUAUUUGCCCAG	Northern blotting (3.0 kb transcript)	11751809 (Urushibata et al., J. Bacteriol. 2002, 184(2):337-343); Genbank Z92954
rbsR,rbsK,rbsD,rbsA,rbsC,rbsB	rbsRKDACB	ND	ND	ND	proposed	7921236 (Woodson & Devine, Microbiology, 1994, 140(Pt.8):1829-1838)
ywsB	ywsB	3706689..3706746	-22.1	UGAGA<left>GGGAUUCCGCA</left>UAAA<right>UGCGGAAUCCC</right>UUUUAUUAUGAAUUG	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92953
ywrO	ywrO	3707158..3707210	-23.4	UAAAA<left>UACAGCCCUGUCC</left>AACAUAC<right>GGCAGGGCUGUA</right>UUUGUUUAAAAAUCC	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z93767
alsS,alsD	alsSD	3707776..3707827	-6.8	AGAAA<left>GCCC</left>CTTTTAGCA<right>GGGC</right>TTTCTTTTTATTTGG	proposed	7685336 (Renna et al., J. Bacteriol. 175(12), 3863-3875, 1993)
ywrJ	ywrJ	3712983..3713039	-11.9	CAAAA<left>CUGCCCUCUUG</left>AAAAG<right>CAGAAGGCAG</right>UUUUUCGUUUCAUAC	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z93767
cotB	cotB	3713721..3713762	-11.4	AUGGA<left>GGAGCAUCA</left>GAUAAAG<right>UGAUGCCC</right>UUUUUCAGUUAAAGG	proposed	Sonenshein	Genbank Z93767 does not list a terminator for cotB. Predicted terminators in Genbank Z93767 suggest a cotHB-ywrJ operon.
cotH	cotH	ND	ND	ND	proposed	8755863 (Naclerio et al., J. Bacteriol. 1996, 178(15):4375-4380)	Sonenshein lists cotH as monocistronic. Predicted terminators in Genbank Z93767 suggest a cotHB-ywrJ operon.
cotG	cotG	3716850..3716913	-14.8	UUCAA<left>UAGGCUGCCG</left>GCGGAGGUA<right>CGGAAGCCUA</right>UUUUUUUAUUUGCCC	proposed	7814326 (Sacco et al., J. Bacteriol. 1995, 177(2):372-377)
ywrE	ywrE	ND	ND	ND	downstream genes are on the opposite strand	9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371)
ywrD	ywrD	3717730..3717781	-19.5	UAAAA<left>GAACACCCCGAG</left>CUUG<right>CUCUGGGUGUUC</right>UUUUUUUUGAUAUUU	Northern blotting (2.0 kb transcript); upstream and downstream genes are on the opposite strand	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)	This terminator is located after the downstream gene ywrE, which is transcribed in the opposite direction.
ywqO	ywqO	3721567..3721613	-10.2	AAAAA<left>GCACCU</left>GUCC<right>AGGUGC</right>UUUUUUCUAUAAAUA	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92952
ywqL	ywqL	3723414..3723461	-12.4	UGUAA<left>CACUUGGGGCU</left>CUA<right>AGUCAUCAAGUG</right>UUUUUUUUGUAUGUG	proposed; downstream gene is on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92952
ywqF	ywqF	3728477..3728519	-10.3	AGAAA<left>GGCUGGU</left>UGCGC<right>ACCAGUC</right>UUUUUUUCAUCUAUU	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92952
ywqA	ywqA	3737231..3737290	-17.9	AAAAA<left>GCUGGCUCU</left>AAA<right>AGAGCCAGC</right>UUUUUUCCGUUCAUA	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z83337
ywpH,glcR	ywpH-glcR	ND	ND	ND	Northern blotting (1.4 kb transcript)	14762004 (Lindner et al., J. Bacteriol. 2004, 186(4):1097-1105)	A longer transcript of 2.4 kb was assumed to be due to readthrough into the downstream ywpJ gene.
ywpE	ywpE	3740699..3740746	-17.0	GAAAA<left>GCUGCCGUU</left>CAA<right>AACGGCAGC</right>UUUUUUCAUGCAGAA	proposed; upstream and downstream gene are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z83337
mscL	mscL	3742257..3742309	-14.2	AAAAA<left>GAUGCCGUU</left>AGA<right>AACGGCGUC</right>UUUUUUUAUCUCAAU	proposed; downstream gene is on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z83337
rapD	rapD	3744728..3744780	-12.1	AAGCC<left>GCUUUUUUUAUCAUGC</left>GCG<right>GCUGAUUGAAAAACGC</right>CCAUUUUCUUAUUAUCUG	proposed; upstream and downstream genes are on the opposite strand	9636707 (Huang & Helmann, J. Mol. Biol. 1998, 279(1):165-173)
mbl,flhO,flhP	mbl-flhOP	3744202..3744239	-23.7	AAAAU<left>GGGCGUUUUUCAAUCAGCCGC</left>GCAUGAUAAAAAAA<right>GCGGCUUUUUCGAAAUCGUCC</right>UUUUUUUUGUAGUAU	Northern blotting (2.8 kb transcript)	15033535 (Serizawa et al., Gene 2004, 329:125-136); 7836311 (Abhayawardhane & Stewart, J. Bacteriol. 1995, 177(3):765-773)	A readthrough terminator AGCTGATTTCAC<left>AAACCTCATTCT</left>GAAAA<right>AGAATGAGGTTT</right>TTTTATGAAAAAGCCTTCACGAA was found downstream of mbl at position 3746248..3746311, leading to a 1.0 kb transcript. The Northern blotting results suggest the existence of an internal promoter in front of flhO, leading to a 1.8 kb transcript.
usd,spoIIID,mbl	usd-spoIIID-mbl	3746235..3746277	-15.1	ACAAA<left>CCUCAUUCU</left>GAAAA<right>AGAAUGAGG</right>UUUUUUUAUGAAAAA	transcriptional fusions; Northern blotting (1.34 kb transcript)	1469717 (Halberg & Kroos, J. Mol. Biol. 1992, 228(3):840-849); 9023218 (Decatur et al., J. Bacteriol. 1997, 179(4):1324-1328); 7836311 (Abhayawardhane & Stewart, J. Bacteriol. 1995, 177(3):765-773)	Note that Stevens & Errington (2112673, Mol. Microbiol. 1990, 4(4):543-551) proposed a different terminator between spoIIID and mbl. The mRNA transcript extends 830 basepairs beyond the spoIIID coding region, which is too short to cover mbl completely. A mbl-specific vegetative promoter may exist inside the spoIIID coding region (Sonenshein page 495).
ywoG	ywoG	3749695..3749741	-22.2	UGUCA<left>GACUGCCGGG</left>AAAU<right>CCCGGCAGUC</right>UUUUUUCCAUUAAAA	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z82987
ywoF	ywoF	3749739..3749792	-27.9	UAUAA<left>GCGGCGUUCUCUCG</left>UUCAAC<right>CGAGAGGGCGCCGU</right>GUUUUAAUGGAAAAAA	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z82987
ywoE	ywoE	ND	-11.0	GGUCC<left>GCCAGGCUGAAUA</left>AGAUC<right>UAUUUAGACGGU</right>AUAUUUUCAUAUUUUUGA	proposed	12029039 (Beier et al., J. Bacteriol. 2002, 184(12):3232-3241)	Synonym: pucI.
ywoD	ywoD	3752915..3752962	-16.2	AGAAA<left>GAGACGGGCU</left>CUGA<right>GGUCUGUCUC</right>UUUUUCUUGUUUAAG	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z82987
nrgA,nrgB	nrgAB	3757383..3757427	-15.8	GGUAC<left>GAGAUUCGGA</left>CAC<right>UCCGGAUCUC</right>UUUUUUUGUGCACAG	primer extension analysis of nrgA and nrgB transcripts; Northern blotting (1.6 kb transcript)	8282685 (Wray et al., J. Bacteriol. 1994, 176(1):108-114); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
ywoA	ywoA	3758152..3758200	-19.3	CAAAA<left>GCCGGCGUCU</left>GAAAUCA<right>AGACAGCCGGC</right>UUUAAUAUUUCUCAU	proposed	12399481 (Cao & Helmann, J. Bacteriol. 2002, 184(22):6123-6129); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328)	bidirectional terminator
ywnJ	ywnJ	3758154..3758199	-19.5	UUAAA<left>GCCGGCUGUCUUG</left>AUUU<right>CAGACGCCGGC</right>UUUUGUCUUUCUUAG	proposed	12399481 (Cao & Helmann, J. Bacteriol. 2002, 184(22):6123-6129); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328)	bidirectional terminator
spoIIQ	spoIIQ	3758682..3758734	-10.6	GAAAA<left>CGUCUAUC</left>CUUGU<right>GAUGGGCG</right>UUUUUUUCUGUUACU	proposed	9140963 (Londono-Vallejo et al., Mol. Microbiol. 1997, 24(1):29-39); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Y08559
ywnF	ywnF	3760956..3761006	-28.4	GAUCU<left>GCACCCGGAUUGUUGAGA</left>UUU<right>UCCAGACGAUCCGGGUGU</right>GUUUUUUUGCAUGCAG	proposed; upstream and downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Y08559
mta	mta	3763131..3763172	-24.3	GAAAA<left>CCCCCGGCC</left>GUAAA<right>GGCCGGGGG</right>UUUACGCAUCUUAUA	upstream and downstream gene are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Y08559
ywnB	ywnB	3764459..3764503	-13.2	AAAAA<left>CCCGGAG</left>CCAG<right>CUCCGGG</right>UUUUUCUCAUUAAUA	proposed; downstream gene is on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Y08559
ureA,ureB,ureC	ureABC	3765701..3765744	-18.3	AGACG<left>CGGCCGGA</left>GUGCA<right>UCCGGCCG</right>UUCUAUUGACUAAAA	Northern blotting (2.6 kb transcript)	9150240 (Cruz-Ramos et al., J. Bacteriol. 1997, 179(10):3371-3373); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
ywmF,csbD	ywmF-csbD	3769081..3769131	-14.6	GAAGA<left>GGCAGGAAAC</left>GAAAU<right>GUUUCUUGUC</right>UUUUUUUUUCGCUUU	proposed	9287005 (Wray et al., J. Bacteriol. 1997, 179(17):5494-5501); 10376822 (Akbar et al., Microbiology 1999, 145(Pt.5):1069-1078)	internal promoter in front of csbD
rapB	rapB	3769989..3770035	-9.9	CAAAA<left>CCAUCUG</left>CUGG<right>CAGAUGG</right>UUUUUUUUUAUGCAA	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
moaA	moaA	3771302..3771354	-12.8	CAAAA<left>GCUUAUCGGC</left>ACU<right>GUCCGGUAAGC</right>UUUUUUAUUAGAAUC	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z81356
ywmE	ywmE	3773249..3773289	-12.8	GUAAA<left>AGCCCUUU</left>AUAU<right>AGAGGGCU</right>CUUUUUGUGUCUCAGA	ND	ND
ywmD	ywmD	3773631..3773684	-12.2	GAUCA<left>GGCGCU</left>CCCCCA<right>GGCGCC</right>UUUUUUAUUGGUUUA	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z81356
ywmC	ywmC	3774638..3774677	-14.0	AAAAA<left>GAGGCUGG</left>UGAUGG<right>UCAGCCUC</right>UUUUUGUAUGUAACA	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z81356
spoIID	spoIID	3775714..3775769	-11.4	AAAAA<left>GACGCUC</left>AUU<right>GGGCGUC</right>UUUUUCUGUUCCUGA	integrational plasmids	3011962 (Lopez-Diaz et al., J. Gen. Microbiol. 1986, 132(Pt.2):341-354)
murAA	murAA	3776915..3776987	-15.0	GAAAA<left>UCAGUAUGUCA</left>CUC<right>UGGCAUACUGG</right>UUUUUUAUUUUUUGU	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z81356
atpC	atpC	3780055..3780111	-14.0	AAAAA<left>UCCUUCUC</left>UUUAU<right>GAGAAGGA</right>UUUUUUUAUGAACGC	proposed; downstream gene is on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
upp	upp	3787414..3787461	-8.6	UGAAA<left>UCCCC</left>AAAA<right>GGGGG</right>UUUCAUUUUUUUAUC	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z38002
glyA	glyA	3788172..3788220	-20.0	UAAAA<left>CCCGCUUGGGC</left>UUAU<right>GCCCGGCGGG</right>UUUUUUGACGAUGUU	proposed	Genbank Z38002	no terminator identified in Genbank L47648
ywlF,ywlG	ywlFG	3789634..3789686	-5.6	GAAAG<left>GACUG</left>CAUAGC<right>CAGUC</right>UUUUCUUUUAUUUUA	Northern blotting (1.1 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z38002
ywlB	ywlB	3793115..3793182	-20.6	UAUUA<left>GCGUUGUCCACA</left>AUU<right>UGUGGAUAACGC</right>UUGUUUUAUUACAGG	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z38002
spoIIR	spoIIR	ND	ND	ND	ND	ND
ywkF	ywkF	3794860..3794905	-14.4	AAAAA<left>GGAAGCCU</left>CUU<right>AGGCUUCC</right>UUUUUUUGCAGUAAA	proposed; downstream gene is on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z49782
ywkA,ywkB	ywkAB	3798366..3798408	-13.2	AAAAA<left>GCUCCCU</left>UUA<right>AGGGAGC</right>UUUUUGCUUUAGGUU	Northern blotting (2.8 kb transcript); genes further downstream are on the opposite strand	12949160 (Doan et al., Microbiology 2003, 149(Pt.9):2331-2343); Genbank Z49782
rpmE	rpmE	3802055..3802098	-14.0	CUCAA<left>CAGGCAAGC</left>AGCA<right>GUCUUGCCUG</right>UUUUUUAUAUUGUCU	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z49782
ywjI	ywjI	3804077..3804119	-14.8	AAAAA<left>GCGGGU</left>GUGA<right>GCCCGC</right>UUUAACUUUUGCAGA	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z49782
fbaA,ywjH	fbaA-ywjH	3806726..3806780	-25.0	AUGAA<left>AGGGGCGGCAAACAGC</left>UUUAU<right>GCCUGUUUGCCGCGGCCU</right>UUGUAUUUCACCGAC	Northern blotting (1.7 kb transcript)	2457578 (Trach et al., J. Bacteriol. 1988, 170(9):4194-4208); 11489127 (Ludwig et al., Mol. Microbiol. 2001, 41(2):409-422)	A readthrough terminator GAACTTTTTATAG<left>CCGCCTGACA</left>GCT<right>TGACAGGCGG</right>TTTTCCGTCTATCTTTAGAAAG was found downstream of fbaA at 3807499..3807556, leading to a 1.0 kb transcript.
spo0F	spo0F	ND	ND	ND	lacZ transcriptional fusions	2457578 (Trach et al., J. Bacteriol. 1988, 170(9):4194-4208)	The stem-loop TGACAAAAAGAAGA<left>AACAAATGA</left>ATCATG<right>TCATTATGTT</right>GCCGAT (dG = -8.6 kcal/mole) proposed by Trach et al. at position 3808531..3808575 seems too weak to function as a terminator.
ywjG	ywjG	3809658..3809717	-13.4	AAAAA<left>GACUUGCC</left>CGCUUUUGACAAAC<right>GGCAAGUC</right>UUUUUUAUUACUUCU	proposed	2457578 (Trach et al., J. Bacteriol. 1988, 170(9):4194-4208)	The indicated terminator was found by mfold. Trach proposes this terminator for the convergently transcribed pyrG gene, but proposes the terminator TCGTTTACACTAA<left>AAGAAATTCTGCA</left>AGAGTA<right>TGCATAATATCTT</right>ATTGTACATGCTGGAACTTGC (dG= -7.0 kcal/mole) at position 3809596..3809661 for ywjG.
pyrG	pyrG	3809671..3809729	-17.9	AAAAA<left>GACUUGCCGUUU</left>GUCAA<right>AAGCGGGCAAGUC</right>UUUUUUAUUUGUUUC	proposed	2457578 (Trach et al., J. Bacteriol. 1988, 170(9):4194-4208)	Bidirectional terminator. Synonym: ctrA.
rpoE	rpoE	3811426..3811474	-24.1	GUUAU<left>GCUCCCUUUCAA</left>GAAA<right>UUGAAAGGGAGC</right>UUUCUUAUUUUCACC	proposed	2457578	(Trach et al., J. Bacteriol. 1988, 170(9):4194-4208)
ywjC	ywjC	3818192..3818244	-13.3	AAAAA<left>GGAUAGAC</left>AUCU<right>GUCUAUCC</right>UUUUUCUUAUGCUCU	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z49782	bidirectional terminator
ywjB	ywjB	3818211..3818253	-13.3	AAAAA<left>GGAUAGAC</left>AGAU<right>GUCUAUCC</right>UUUUUUGUAUGUAAG	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z49782	bidirectional terminator
ywjA	ywjA	ND	ND	ND	proposed	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629)
narG,narH,narJ,narI	narGHJI	3822551..3822589	-15.9	AAAAU<left>CCCCCUU</left>GCAA<right>GAGGGGG</right>UUUUUUCUGCCAAGG	proposed	8846791 (Cruz-Ramos et al., EMBO J. 1995, 14(23):5984-5994); Genbank Z49884
arfM	arfM	3829146..3829192	-12.9	UGAGC<left>CCGGUUCU</left>UAAAU<right>AGAGCCGG</right>UUUUUUUUGAUCUUU	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z97884
narK,fnr	narK-fnr	3830502..3830546	-12.8	AAAAA<left>CAAGGACA</left>GCGG<right>UGUCCUUG</right>UUUUUUUACCUUGUG	Northern blotting (2.0 kb transcript)	8846791 (Cruz-Ramos et al., EMBO J. 1995, 14(23):5984-5994)	Internal promoter in front of fnr, leading to a 0.7 kb monocistronic fnr transcript. A stem-loop structure between narK and fnr apparently does not function as a terminator
argS	argS	3832631..3832675	-17.9	CAAAA<left>GGACAAAGUC</left>UUCG<right>GGCUUUGUCC</right>UUUUUUUAUGAGAAA	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z97024
sboA,sboX,albA,albB,albC,albD,albE,albF,albG	sboAX-albABCDEFG	ND	ND	ND	proposed	10572140 (Zheng et al., J. Bacteriol. 1999, 181(23):7346-7355)	The terminator structure proposed in Genbank Z97024 lacks a T-stretch. A potential readthrough terminator CTA<left>TGGGGG</left>TAAGGAT<right>CTCCCA</right><left>AAAGGGCATAGT</left>CATTCT<right>ACTATGCCCTTT</right>TTAA exists at 3835201..3835256 downstream of sboA.
phrF	phrF	3846267..3846298	-12.0	UUUAA<left>CCGCCG</left>UCCAU<right>CGGCGG</right>UUUUUUCGUCCCCUC	proposed	11466295 (McQuade et al., J. Bacteriol. 2001, 183(16):4905-4909); Genbank Z80360
ywhH	ywhH	3846829..3846881	-15.1	AAAAA<left>CAUCCAGAC</left>AUC<right>GUCUGGAUG</right>UUUACUUAUUUCACA	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z80360	bidirectional terminator
speB	speB	3846840..3846893	-15.1	GUAAA<left>CAUCCAGAC</left>GAU<right>GUCUGGAUG</right>UUUUUUUAUUCCCAG	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z80360; SubtiList	bidirectional terminator
speE	speE	3847772..3847805	-15.2	GUAUG<left>GCGCAGGA</left>GCGAA<right>UCUUGCGC</right>UUUUUUACAGGAAAG	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z80360
ywhE	ywhE	ND	ND	ND	upstream and downstream genes are transcribed in the opposite direction	ND
ywhA	ywhA	3852692..3852735	-18.4	UAAAA<left>GCCGGUGC</left>GCGAA<right>GCGCCGGC</right>UUUAUAGAGAUUAUU	proposed; downstream gene is on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z80360
mmr	mmr	3855734..3855789	-21.2	AUCAA<left>CACAUUCGUCCCUU</left>UUA<right>GAGGGAUGGGUGUG</right>UUUUUUUAUUUGAAU	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywgA	ywgA	3857979..3858032	-15.0	ACCAA<left>GCAAAAGAAAU</left>GAUCC<right>GUUUCUUUUGC</right>UUUUUUUAUUGACAA	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z80355 (aagcaaaaga aatgatccgt ttcttttgct t)
rsfA	rsfA	3861226..3861275	-17.9	AAAAA<left>UCCCAAAACGG</left>GCAG<right>CUGUUUUGGGA</right>UUUUCGCCAUGUGCA	upstream and downsteam genes are in the opposite direction	7934828 (Glaser et al., Mol. Microbiol. 1993, 10(2):371-384)
ywfL	ywfL	3862392..3862437	-24.5	UCUUC<left>GCAUGCCGGC</left>UGUAUAU<right>GCCGGCAUGC</right>AUUUUUUAUCUCAAGC	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywfK	ywfK	ND	ND	ND	proposed	12169591 (Guillouard et al., J. Bacteriol. 2002, 184(17):4681-4689)	synonym: cysL
pta	pta	3864331..3864368	-21.0	ACAAU<left>GGCAGCUCUC</left>GACC<right>GAGGGCUGCC</right>UUUUUUGCGCUUCUG	proposed	10423526 (Shin et al., J. Biochem. (Tokyo) 1999, 126(2):333-339)
ywfI	ywfI	3866375..3866432	-14.0	CCCCG<left>CCCGCC</left>CUAUCC<right>GGCGGG</right>AGUUUUUCAAUUCUCCU	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywfA	ywfA	3873299..3873353	-7.9	AAAAA<left>CCCUU</left>UUUA<right>AAGGG</right>UUUUUUUGUUUGUAU	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
rocA,rocB,rocC	rocABC	3874764..3874809	-19.0	AAAAA<left>GCUCUCCGG</left>GAGG<right>CCGGAGAGC</right>UUUUUUUACGUGUUA	proposed	8113162 (Calogero et al., J. Bacteriol. 1994, 176(5):1234-1241); SubtiList
rocG	rocG	3879722..3879755	-7.6	CCUCC<left>GCAAAA</left>UAA<right>UUUUGC</right>AUUUGUUUUUUGCGUA	proposed	10468601 (Belitsky & Sonenshein, Proc. Natl Acad. Sci. USA 1999, 96(18):10290-10295)
yweA	yweA	3881165..3881205	-14.7	AGUCA<left>GAGACUGAGA</left>UGU<right>UUUCAGUCUC</right>UUUUUUUGUGGAUUC	Northern blotting (0.6 kb transcript)	10468601 (Belitsky & Sonenshein, Proc. Natl Acad. Sci. USA 1999, 96(18):10290-10295); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
spsL	spsL	3881952..3881993	-14.0	AUCAA<left>UCGAAGAGC</left>AGAG<right>GCAUCUUCGA</right>CUUUUUUUGCCCUUUU	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywdL	ywdL	3892993..3893048	-17.9	AAAAA<left>GCCAAUCACUCAU</left>AUG<right>AUGAGGAUUGGC</right>UUUUUUGUUUAUAGA	proposed; upstream and downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList	bidirectional terminator
ywdI,ywdJ,ywdK	ywdIJK	3893003..3893066	-17.9	AAAAA<left>GCCAAUCCUCAU</left>CAU<right>AUGAGUGAUUGGC</right>UUUUUUCUUAUCUUG	Northern blotting (2.2 kb transcript); downstream gene is on the opposite strand	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList	bidirectional terminator
ywdH	ywdH	3896665..3896720	-11.6	AAAAA<left>GCGCAG</left>AUCAC<right>CUGCGC</right>UUUUUACAAAUCCUU	proposed; upstream and downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList	bidirectional terminator, assumed same as ung.
ung	ung	3896673..3896710	-11.8	AAAAA<left>GCGCAGG</left>UGA<right>UCUGCGC</right>UUUUUUAUUUGAGUA	proposed; downstream gene is on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList	bidirectional terminator
thiD	thiD	3900784..3900838	-22.0	AAAAG<left>GGGCUGCCUU</left>ACAGA<right>GAGGCAGCCC</right>UUUUUAAAUCACCGA	proposed	3100393 (Fouet et al., Gene 1986, 45(2):221-225); SubtiList
sacP,sacA,ywdA	sacPA-ywdA	3900846..3900917	-13.4	ACAGG<left>CUGCCGAU</left>GGG<right>AUCGGCAG</right>UUUUUUCUGUGAAAA	proposed	2163394 (Debarbouille et al., J. Bacteriol. 1990, 172(7):3966-3973); 3100393 (Fouet et al., Gene 1986, 45(2):221-225)	the terminators suggested by Fouet et al. are located behind the ywdA gene, whose existence was unknown.
ywcJ	ywcJ	ND	ND	ND	proposed; upstream and downstream genes are on the opposite strand	8846791 (Cruz-Ramos et al., EMBO J. 1995, 14(23):5984-5994); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328)
sacT	sacT	3905122..3905168	-12.5	UUUGA<left>CUUGCAGGGA</left>GUGA<right>UCUCUGGAAG</right>UUUUUUUAUUGAUCA	proposed; downstream gene is on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
vpr	vpr	3909275..3909320	-20.0	AAAAA<left>GCCCUGCCG</left>AUU<right>CGGCAGGGC</right>UUUUUAAAGAUCAGU	proposed; upstream and downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
nfrA,ywcH	nfrA-ywcH	3909286..3909329	-20.0	AAAAA<left>GCCCUGCCG</left>AAU<right>CGGCAGGGC</right>UUUUUCUUAUUCAAC	Genetic analysis; Northern blotting (2.0 kb transcript); downstream gene is on the opposite strand	10913069 (Moch et al., J. Bacteriol. 2000, 182(16):4384-4393)	SubtiList and also Presecan et al. (9353933) show a terminator GGCTTTAATAAAAACTAAAGC<left>AAACCTCTCC</left>GTCT<right>GGAGGGGTTT</right>TTATGTTTCACGTGTAAC at 3910455..3910517 between nfrA and ywcH. Moch suggests that this stem-loop may function as a (readthrough?) terminator, even though nfrA and ywcH constitute an operon.
rodA	rodA	3911320..3911364	-16.0	AUGCA<left>GACAGCCUU</left>UACA<right>GAGGCUGUC</right>UUUUUUUGUGCAGAG	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywcE	ywcE	3913289..3913339	-13.9	AAAAA<left>CCCUCUUC</left>CACU<right>GAAGAGGG</right>UUUUUUGUAUUAUUC	proposed; upstream and downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList	bidirectional terminator
qoxD	qoxD	3913300..3913354	-15.2	AAAAA<left>CCCUCUUC</left>AGUG<right>GAAGAGGG</right>UUUUUUGCUGUCUUC	proposed; upstream and downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList	bidirectional terminator
ywzA	ywzA	3918029..3918086	-19.0	AGCAG<left>CACCCGAAGCG</left>UCAG<right>CGCUUUGGGUG</right>UUUGUUUUGCCAUAA	proposed; upstream and downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328)
galK,galT	galKT	3918091..3918135	-18.4	CAAAA<left>GCCUCAACC</left>GCUAG<right>GGUUGAGGC</right>UUUUUUCGAUUUUUA	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList	bidirectional terminator
ywbO	ywbO	3924784..3924833	-11.2	AAAAA<left>GCUCUC</left>GAUAAA<right>GAGAGC</right>UUUUUUUAUUCCUGU	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywbN	ywbN	ND	ND	ND	proposed	9636707 (Huang et al., J. Mol. Biol. 1998, 279(1):165-173); 9683469 (Huang et al., J. Bacteriol. 1998, 180(15):3765-3770)	the terminators predicted by Presecan (9353933) suggest that ywbN is part of a ywbLMN operon
ywbL	ywbL	ND	ND	ND	proposed	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629)	the terminators predicted by Presecan (9353933) suggest that ywbL is part of a ywbLMN operon
ywbI,thiM,thiE	ywbI-thiME	3929679..3929733	-12.8	AAAGG<left>GCUGUUCU</left>GUAAA<right>AGGACAGC</right>UUUUUUGCUGUCCAU	Northern blotting (2.4 kb transcript)	9139923 (Zhang et al., J. Bacteriol. 1997, 179(9):3030-3035)
ywbC	ywbC	3936522..3936575	-15.6	AUAAA<left>GAACGUACAUU</left>UUGU<right>GAUGUACGUUC</right>UUUUUUAUCUAUACC	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList	bidirectional terminator
ywbB	ywbB	3936535..3936582	-14.5	AAAAA<left>GAACGUACAU</left>CACAAA<right>AUGUACGUUC</right>UUUAUUUUUACCGCU	proposed; downstream gene is on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList	bidirectional terminator
epr	epr	3940819..3940876	-16.6	AAAAA<left>CCUUUAAGAUUUG</left>CAUUC<right>CAAGUCUUAAAGG</right>UUUUUUUCAUUCUAA	proposed	3142851 (Stroma et al., J. Bacteriol. 1988, 170(12):5557-5563); 1400159 (Crutz & Steinmetz, J. Bacteriol. 1992, 174(19):6087-6095)
sacX,sacY	sacXY	3943521..3943575	-13.4	AAAAA<left>CGCUUUUGA</left>UCAUC<right>UCAAAAGCG</right>UUUUUUUAUCUGAUU	lacZ gene fusion	 1400159 (Crutz & Steinmetz, J. Bacteriol. 1992, 174(19):6087-6095); 2116367 (Zukowski et al., Gene 1990, 90(1):153-155)	bidirectional terminator
gspA	gspA	3943534..3943591	-14.1	AAAAA<left>CGCUUUUGA</left>GAUGA<right>UCAAAAGCG</right>UUUUUUGUUUGUCUC	Northern blotting (0.95 kb transcript)	7768864 (Antelmann et al., J. Bacteriol. 1995, 177(12):3540-3545)	bidirectional terminator
tyrZ	tyrZ	3947417..3947468	-12.9	CGAAA<left>CGCUUAUGA</left>CCCUUCAU<right>UCAUAAGCG</right>UUUUUUUGCAGGUAU	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywaD	ywaD	3948930..3948977	-16.2	AAAAA<left>GACGGCAC</left>UUGG<right>GUGCCGUC</right>UUUUUUAAUCCACUU	proposed; downstream genes are on the opposite strand	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList	bidirectional terminator
ywaC	ywaC	3948938..3948998	-15.7	AAAAA<left>GACGGCAC</left>CCAA<right>GUGCCGUC</right>UUUUUUUAUUUGAUA	downstream genes are on the opposite strand	11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList	bidirectional terminator
menA	menA	3949710..3949757	-11.2	AAAAA<left>GACCGC</left>UCGUUUCAU<right>GCGGUC</right>UUUUUUUGUUACAAU	proposed	9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
dltA,dltB,dltC,dltD,dltE	dltABCDE	3956244..3956287	-16.6	AACAC<left>GCAGGAGAA</left>UUAAU<right>UUCUCCUGC</right>UUUUUUCAUAUGAAU	proposed	7797557 (Perego et al., J. Biol. Chem. 1995, 270(26):15598-15606)
ywaA	ywaA	3957492..3957538	-16.2	AAAAA<left>GCCGGCC</left>CAUUACA<right>GGCCGGC</right>UUUUUUUACGCUUCA	Northern blotting (1.3 kb transcript); downstream genes are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328)	bidirectional terminator
licB,licC,licA,licH	licBCAH	3957502..3957551	-19.6	AAAAA<left>GCCGGCCU</left>GUAAU<right>GGGCCGGC</right>UUUUUUCUUACUUGC	Northern blotting (3.4 kb transcript)	8990303 (Tobisch et al., J. Bacteriol. 1997, 179(2):496-506); Genbank Z49992	bidirectional terminator
licR	licR	ND	ND	ND	Northern blotting (2.0 kb transcript)	8990303 (Tobisch et al., J. Bacteriol. 1997, 179(2):496-506)	Tobisch at el. propose the terminator structure UAUACCU<left>UUUUUCCGU</left>UGCU<right>GCGGAAAAA</right>CCCUGAGUGUUUAU (dG = -12.1 kcal/mole) at position 3960971..3961013 downstream of licR. However, this stem-loop structure is missing a T-stretch.
yxlJ,yxzF	yxlJ-yxzF	3963093..3963135	-13.4	UAGAA<left>CAGCCGG</left>CUGAUC<right>CCGGCUG</right>UUUUUUUAUAGGUCA	Northern blotting (0.9 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); 8990303 (Tobisch et al., J. Bacteriol. 1997, 179(2):496-506)	The 0.9 kb transcript is sufficient to cover both yxlJ and yxzF. The figure in Yoshida's paper suggests a yxlJ-yxzF transcript, but such an operon is not mentioned in the text. Internal promoter in front of yxzF.
katX	katX	3965655..3965704	-17.7	GCGAA<left>CAGGGCUUU</left>UUUA<right>GAAGCCCUG</right>UUUUUUUAUUUUUCU	Northern blotting (1.8 kb transcript)	10503549 (Petersohn et al., Mol. Gen. Genetic. 1999, 262(1):173-179); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
sigY,yxlC,yxlD,yxlE,yxlF,yxlG	sigY-yxlCDEFG	3965789..3965845	-13.1	AAAAA<left>CGGCGT</left>GATCTAAA<right>GCGCCG</right>ATTGTTTTTTTCTGAG	Northern blotting (4.3 kb transcript)	14769884 (Tojo et al., J. Biochem. 2003, 134(6):935-946); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	Both Tojo and Yoshida found mRNA transcripts (4.2 kb, 4.3 kb, and 4.8 kb) that extended into the coding region of the downstream yxlH gene.
yxlA	yxlA	3971423..3971467	-16.3	GAAAA<left>GCUGUCUUC</left>UCUCU<right>GAAGACAGC</right>UUUUUUAUCAUUCAA	Northern blotting (1.5 kb transcript); upstream and downstream genes are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF
yxkO	yxkO	3971430..3971475	-16.6	AAAAA<left>GCUGUCUUC</left>AGAGA<right>GAAGACAGC</right>UUUUCUUGAUACCCC	Northern blotting (1.0 kb transcript); downstream gene is on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
cydA,cydB,cydC,cydD	cydABCD	3972352..3972387	-13.2	UAAAA<left>GACAGCC</left>CUAAAA<right>GGCUGUC</right>UUUUUUGUUUGAAAA	Northern blotting (6.0 kb transcript)	9852001 (Winstedt et al., J. Bacteriol. 1998, 180(24):6571-6580); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	Various shorter transcripts were found by Yoshida, which may be a result of the mRNA molecule being highly unstable (see Winstedt).
yxkJ	yxkJ	3980114..3980169	-17.7	CGCAA<left>GCAAGUUCUUCGU</left>CAA<right>ACGAAAGAGCUUGC</right>UUUUUUGCAUGUCCA	Northern blotting (1.5 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF	A shorter (0.7 kb) transcript was also measured. Its significance is unclear.
yxkI	yxkI	ND	ND	ND	Northern blotting (2.0 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	A 1.1 kb and a 2.0 kb transcript were found. The 1.1 kb transcript is too short to cover the yxkI gene. The 2.0 kb transcript may be long enough to cover yxkI and the downstream yxzE, but is not indicted as such in Yoshida's paper.
yxzE	yxzE	3982168..3982211	-17.9	GGAGG<left>GGGCGGCG</left>AUUAAA<right>CGCCGCCU</right>UUUUUUAUUUCAUUG	downstream genes are on the opposite strand	9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371); SubtiList
yxkH	yxkH	3982062..3982089	-10.0	GCUGU<left>CCGCC</left>UGCU<right>GGCGG</right>CUUUUGUUUUUCGAGG	Northern blotting; downstream gene is on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF	A 1.0 kb and a 1.2 kb transcript was found. The significance of the two transcript lengths is unknown.
yxkF,msmX	yxkF-msmX	3983110..3983151	-19.7	AAAAA<left>CCGGACAUG</left>GAGA<right>CAUGUCCGG</right>UUUUUUGCUAUUGAA	Northern blotting (2.3 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF; SubtiList	internal promoter in front of msmX, leading to a 1.3 kb transcript.
yxkD	yxkD	3986903..3986957	-17.0	AAAAA<left>UCCCUCUGU</left>ACUUGAA<right>ACAGAGGGA</right>UUUUUUCAUUUAGAA	Northern blotting (1.1 kb transcript); upstream and downstream gene are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxkC	yxkC	3988881..3988931	-16.8	AACAA<left>GGGUGCCU</left>GUUU<right>AGGCACCC</right>UUGUUCUUUAAAAAA	Northern blotting (0.7 kb transcript); downstream gene is on the opposite strand	15033535 (Serizawa et al., Gene 2004, 329:125-136); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
galE	galE	3988912..3988984	-18.5	AUGGA<left>GGCCUUCUC</left>AAUU<right>GAGAAGGCC</right>UUUUUUAAAGAACAA	Northern blotting (1.2 kb transcript); downstream gene is on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF
yxjN	yxjN	ND	ND	ND	Northern blotting (0.6 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
pepT	pepT	3995322..3995366	-17.0	CAAAA<left>GCCAGUCC</left>AAAAAA<right>GGACUGGC</right>UUUUUUGUGUGAAAA	Northern blotting (1.4 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF; SubtiList	A longer (2.0 kb) transcript was also detected. Its significance is unclear.
yxjJ,yxjI	yxjJI	3996914..3996952	-17.7	UUCAA<left>GCUCUUCCUU</left>ACACA<right>AAGGAAGAGC</right>UUUUUACAUGCUUAA	proposed	9537385 (Dartois et al., J. Bacteriol. 1998, 180(7):1855-1861)	Northern blotting experiments by Yoshida (10746760) show various transcripts of different lengths, some long enough to cover a yxjIJ operon. Internal promoter in front of yxjI.
yxjH	yxjH	3998297..3998342	-17.7	CGCAA<left>GCUCUUCCUU</left>AUCCA<right>AAGGAAGAGC</right>UUUUUUAUAUUUGAA	Northern blotting (1.5 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); 10094622 (Grundy & Henkin, Mol. Microbiol. 1998, 30(4):737-749)
yxjG	yxjG	3999497..3999557	-17.1	AAAAA<left>CACACUUGAUUCC</left>CUAGC<right>GGAGCAAGUGUG</right>UUUUUAAUGUCAUUG	Northern blotting (1.5 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); 10094622 (Grundy & Henkin, Mol. Microbiol. 1998, 30(4):737-749); SubtiList	bidirectional terminator
yxjC,scoA,scoB,yxjF	yxjC-scoAB-yxjF	3999511..3999572	-15.9	AAAAA<left>CACACUUGCUCC</left>GCUAG<right>GGAAUCAAGUGUG</right>UUUUUUUCUUUGCUU	Northern blotting (3.8 kb transcript)	12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF; SubtiList	bidirectional terminator
yxjB	yxjB	4003265..4003318	-9.6	GGAAA<left>GCUCC</left>GAAAAAA<right>GGAGC</right>UUUCCUUUUUUAAUC	Northern blotting (1.0 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); SubtiList
yxjA	yxjA	4005964..4006005	-20.1	ACAUU<left>GAGCCAUAUCC</left>CUUUUC<right>GGAUAUGGCUC</right>UUUUCAUUAUUGAUA	Northern blotting (1.3 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579);BSORF; SubtiList	The Northern blotting results in BSORF show a 1.5 kb and a 2.5 kb transcript.
yxiT	yxiT	4005962..4006002	-22.8	CAAUAAUGAAAA<left>GAGCCAUAUCC</left>GAAAAG<right>GGAUAUGGCUC</right>AAUGUUUCUACCACACA	Northern blotting (0.8 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	The genome sequence between yxiT and the indicated terminator contains an ORF homologous to Bacillus licheniformis BL05383, yjeAA (BL00500), and Clostridium perfrigens gene CPE2311. Another potential terminator CUAUA<left>UAGCUAUAUC</left>AAAAAACAC<right>GAUGUGCUG</right>UUUUUCUCUGAUGUA is located 250 base-pairs downstream of the yxiT stop codon. The indicated terminator agrees better with the Northern blotting result.
katE,yxiS	katE-yxiS	4006789..4006836	-9.4	AAAAA<left>GAGACAU</left>CCU<right>GUGUCUC</right>UUUUUUUAUUGGAAA	Northern blotting (2.5 kb transcript measured by Yoshida; 2.4 kb transcript measured by Engelmann)	7559348 (Engelmann et al., J. Bacteriol. 1995, 177(19):5598-5605); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	Synonym: katB-yxiS
citH	citH	ND	ND	ND	Northern blotting (1.5 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
licT,bglS	licT-bglS	4010814..4010855	-19.3	UGAAA<left>GAGCCUGCUG</left>CAAUA<right>UAGCAGGCUC</right>UUAUGAUUGUAAUGA	Northern blotting (2.4 kb transcript)	8606172 (Schnetz et al., J. Bacteriol. 178(7), 1971-1979, 1996)	A terminator-antiterminator structure ACATTCACATATGAAAATGGTA<rat>GGATTGTTACTGATAAAGCAGGC<left>AAAACC</rat>TAAATTGCAATGAGTGCGGAT</left>CATCTCT<right>GTCTGTGCTGATGGTAATTTAGGTTTT</right>TATTTTTTTCAGAGGGAAGATGATGATAGTTACAGGATTCAAGTTAGTAAGATT was found at position 4011681..4011840 downstream of licT, leading to a 0.9 kb transcript)
yxiO	yxiO	4014959..4015013	-10.6	GCUGA<left>CACACCGUCAAUUUUG</left>GCAAUCGUUCCUA<right>CAAAAUCAACGGCUCUG</right>AUUUUCUUUUUCUUUC	Northern blotting (1.5 kb transcript); upstream and downstream genes are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF	The Northern blotting results also show a 0.7 kb transcript, which would be too short to cover yxiO.
yxiM,deaD	yxiM-deaD	4014964..4015015	-22.1	AUGAA<left>UGACCUGCUCC</left>CAGUUAAA<right>GGGGCAGGUCA</right>UUUUGCUGCUGGCUG	Northern blotting (2.7 kb transcript); downstream genes are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	Internal promoter in front of deaD, leading to a 1.6 kb transcript. A short (500 bp) transcript was found at the beginning of yxiM.
wapA,yxxG	wapA-yxxG	4021841..4021889	-17.0	AUAAA<left>GCUUGUAUCG</left>AUAAG<right>CGAUACAAGC</right>UUUUUUAGAACAAAU	Northern blotting (8.0 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxxF	yxxF	4029691..4029741	-10.0	UAAAA<left>AGGCC</left>UAUGC<right>GGCCU</right>UUUUUUGUUUUAGGU	Northern blotting (1.0 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); SubtiList
bglP,bglH,yxiE	bglPH-yxiE	4030776..4030814	-11.9	AAAAA<left>GCGCC</left>CUUG<right>GGCGC</right>UUUUUUUUAUUUAGA	Northern blotting (4.0 kb transcript)	 10913081 (Antelmann et al, J. Bacteriol. 2000, 182(16):4478-4490); 7883710 (Le Coq et al., J. Bacteriol. 1995, 177(6):1527-1535); 8626332 (Kruger et al., J. Bacteriol. 1996, 178(9):2637-2644); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	Internal promoter in front of yxiE, leading to a 0.5 kb transcript.
yxiD,yxxD,yxxE	yxiD-yxxD-yxxE	4034936..4035001	-12.3	CAUAA<left>CCUUGAUUGG</left>AAAAAAUG<right>CCUUUCAAGG</right>UUUUUAAUUACAAUA	proposed	7883710 (Le Coq et al., J. Bacteriol. 1995, 177(6):1527-1535)	yxiD and yxxD overlap. Northern blotting by Yoshida (10746760) showed one 1 kb transcript in the yxiD-yxxD region and one 700 bp transcript for yxxE. Both of these transcripts are too long to infer that these genes are transcribed monocistronically, but too short to cover a yxiD-yxxD-yxxE operon. The stem-loop GCAAAACCU<left>AAAUGGUGCAGGUGCAGGAG</left>GAGA<right>CUCUCGCAAUCUGUGUCAUUU</right> (dG = -23.7 kcal/mole) further downstream at position 4034736..4034789 (listed in SubtiList) is part of the terminator-antiterminator complex in front of bglP.
yxiB	yxiB	ND	ND	ND	Northern blotting (0.3 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxiA	yxiA	4038447..4038491	-10.0	GAAGC<left>GCCUUC</left>GAGG<right>GAAGGU</right>GUUUUUUUAUGAGCUU	Northern blotting (1.5 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579);BSORF; SubtiList
hutP,hutH,hutU,hutI,hutG,hutM	hutPHUIGM	4047970..4048028	-13.7	AAAAA<left>GCACACCCC</left>GCUCAGCAU<right>GGGAUGUGC</right>UUUAUUUUUUAUUCU	Northern blotting (8.0 kb transcript); 5' primer extension analysis of hutP, hutH, and hutU	7704263 (Yoshida et al., Microbiology 1995, 141(Pt.2):337-343); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); 14763987 (Oda et al., Mol. Microbiol. 2004, 51(4):1155-1168); 2454913 (Oda et al., J. Bacteriol. 1988, 170(7):3199-3205); 8071225 (Wray & Fisher, J. Bacteriol. 1994, 176(17):5466-5473); 10712704 (Oda et al., Mol. Microbiol. 2000, 35(5):1244-1254)	A terminator/antiterminator structure was found between hutP and hutH (terminator CATATGAAACAGCCCATAGATCTTAG<left>ACGATAGGGGGCTATGCGTGAA</left>AACAGAAG<right>TTCACAGCATAGCTCCTTTTTGT</right>ATGGGCGCTTTACCAAAGTAAAGAAAAAGGAGTT at position 4040721..4040833), leading to a 0.6 kb transcript.
deoR,dra,nupC,pdp	deoR-dra-nupC-pdp	4047986..4048037	-17.2	AUAAA<left>GCACAUCCC</left>AUGCUGAGC<right>GGGGUGUGC</right>UUUUUUAAUUAUAGG	Northern blotting (4.5 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); 7704263 (Yoshida et al., Microbiology 1995, 141(Pt.2):337-343); 8550462 (Saxild et al., J. Bacteriol. 1996, 178(2):424-434)	Bidirectional terminator. A 3.4 kb dra-nupC-pdp transcript was also detected, as well as a monocistronic (1.0 kb) dra transcript terminating at the putative readthrough terminator CAGGCGGAGACAACTATTAAGAGCTG<left>ACGGAAGGCA</left>GAC<right>TGCTTTCCGT</right>TTTCTGAGGAAACAGTAATTGTAAGCG at position 4050564..4050639 downstream of dra. Northern blotting results by Yoshida also showed a monocistronic (0.8 kb) deoR transcript.
yxeR,yxxB	yxeR-yxxB	4052434..4052469	ND	ND	Northern blotting (2.4 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	yxeR and yxxB monocistronic transcripts (1.4 kb and 1.0 kb, respectively) were also detected
yxeK,yxeL,yxeM,yxeN,yxeO,yxeP,yxeQ	yxeKLMNOPQ	ND	ND	ND	Northern blotting (7.0 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF
yxeI,yxeJ	yxeIJ	ND	ND	ND	Northern blotting (1.2 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF
yxeF,yxeG,yxeH	yxeFGH	4062656..4062700	-17.7	AAAAA<left>AUCCAGCCUU</left>CUA<right>AAGGCUGGAU</right>CUUUUCGUUUUAUUUG	Northern blotting (2.5 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); SubtiList; BSORF	Internal promoter in front of yxeH, leading to a 0.9 kb transcript.
yxeE	yxeE	4064956..4065025	-4.3	UGUAG<left>UUCCUC</left>UUU<right>GACGGAA</right>UUUCUUUUCAUUCAA	Northern blotting (0.4 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxeD	yxeD	4065569..4065623	-19.1	UAAAA<left>GGCUCAACAC</left>AAUGCGA<right>GUGUUGAGCC</right>UUUUUCCUUACUGUU	Northern blotting (0.4 kb transcript); downstream gene is on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); SubtiList
yxeC	yxeC	4065577..4065628	-18.9	AAAAA<left>GGCUCAACAC</left>UCGCAUU<right>GUGUUGAGCC</right>UUUUAUAUGUUACUG	Northern blotting (0.5 kb transcript); upstream and downstream gene are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxeB	yxeB	4067141..4067200	-17.4	AAAAA<left>CGGCACAGU</left>CAUGAC<right>GCUGUGCCG</right>UUUUUUAUGAUUCAC	Northern blotting (1.1 kb transcript); upstream and downstream genes are on the opposite strand	12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF; SubtiList
yxdJ,yxdK	yxdJK	4070247..4070296	-18.4	UUGUU<left>UCCCCUUGAUA</left>ACAUGGAUUUA<right>UGUCAAGGGGA</right>UUUUUAUGUUGAACG	Northern blotting (1.7 kb transcript)	7952181 (Yoshida et al., Microbiology 140(Pt.9):2289-2298); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
mmsA,iolB,iolC,iolD,iolE,iolF,idh,iolH,iolI,fbaB	mmsA-iolBCDEF-idh-iolHI-fbaB	4072060..4072099	-8.1	GAAAC<left>CGCC</left>GAGAU<right>GGCG</right>UGUUUUUUUGUGCGGUG	S1 nuclease mapping of the 3' end; Northern blotting (11.5 kb transcript)	7952181 (Yoshida et al., Microbiology 1994, 140(Pt.9):2289-2298); 9226270 (Yoshida et al., J. Bacteriol. 1997, 179(14):4591-4598); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	The proposed terminator agrees well with the experimentally determined termination site in the TTTTTTT stretch.
iolR,iolS	iolRS	4085550..4085601	-21.5	GAAAA<left>CAGCCUUCUCC</left>AAU<right>GGAGAAGGCUG</right>UUUUUUUGUGCGAUA	Northern blotting (2.0 kb transcript); S1 nuclease mapping of the 3' end (transcription ends in the CTGT region just in front of the T-stretch)	9226270 (Yoshida et al., J. Bacteriol. 1997, 179(14):4591-4598)
yxcE,yxcD	yxcED	4086779..4086830	-11.5	UCAAA<left>CCUUACUC</left>CGCGC<right>GGGUAAGG</right>UUUUUUUAAUGGUUU	Northern blotting (1.2 kb transcript)	10376822 (Akbar et al., Microbiology, 1999, 145(Pt.5):1069-1078); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
csbC	csbC	4088392..4088448	-20.0	AAAAA<left>GGAAUCGUCUC</left>CUUAU<right>GAGACGAUUCC</right>UUUUUCUGUUUACAC	Northern blotting (1.5 kb transcript)	10376822 (Akbar et al., Microbiology, 1999, 145(Pt.5):1069-1078); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF
htpG	htpG	4088404..4088453	-21.4	AAAAA<left>GGAAUCGUCUC</left>AUAAG<right>GAGACGAUUCC</right>UUUUUUUAUAAUGUA	Northern blotting (1.9 kb transcript)	9150201 (Schulz et al., J. Bacteriol. 1997, 179(10):3103-3109)
yxbG	yxbG	4091656..4091711	-13.0	AAUAA<left>GAGAGGG</left>AGCC<right>CCCUCUC</right>UUUUUGUCUUUUAAA	Northern blotting (0.9 kb transcript); upstream and downstream gene are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxbF	yxbF	4091673..4091721	-17.0	ACAAA<left>AAGAGAGGG</left>GGCU<right>CCCUCUCUU</right>AUUUCGUUUCUUCCUU	Northern blotting (1.3 kb transcript); upstream and downstream gene are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
aldX	aldX	4094339..4094382	-15.5	CAAAA<left>GGCGCUUCCU</left>UAG<right>AGGAGCGCC</right>UUUUAUUGUAACUCC	Northern blotting (1.3 kb transcript); downstream gene is on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); SubtiList
yxbC,yxbD	yxbCD	4094345..4094392	-15.5	UAAAA<left>GGCGCUCCU</left>CUA<right>AGGAAGCGCC</right>UUUUGAUCAUGCGAU	Northern blotting (2.3 kb transcript); downstream gene is on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	A readthrough terminator may exist downstream of yxbC, leading to a 1.1 kb transcript.
yxbB,yxbA,yxnB,asnH,yxaM	yxbBA-yxnB-asnH-yxaM	4101393..4101445	-24.4	AUCAC<left>AGUAAGAAGACCUUCUU</left>AUUAA<right>AAGAAGGUCUUCUGCU</right>AUUCUAUUCAGUUAUU	Northern blotting (5.5 kb transcript)	10498721 (Yoshida et al., J. Bacteriol. 1999, 181(19):6081-6091); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	Yoshida et al. (10746760) found several shorter transcripts, starting at the promoter in front of yxbB. These transcripts are not mentioned in Yoshida's 1999 paper.
yxaJ,yxaL	yxaJL	4101398..4101447	ND	ND	Northern blotting (2.0 kb transcript); genes downstream are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	an internal promoter exists in front of yxaL, leading to a 1.4 kb transcript
yxaI	yxaI	4103926..4103969	-16.7	AAAAA<left>GUCUAGACGCC</left>AAUA<right>GGCAUCUAGAC</right>UUUUGUUUUCUUUGC	Northern blotting (0.6 kb transcript); upstream and downstream genes are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxaG,yxaH	yxaGH	4103921..4103966	-19.5	CAAAA<left>GUCUAGAUGCC</left>UAUU<right>GGCGUCUAGAC</right>UUUUUUCUAUUAUUU	Northern blotting (2.5 kb transcript)	15317768 (Yoshida et al., J. Bacteriol. 2004, 186(17):5640-5648); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxaF	yxaF	ND	ND	ND	Northern blotting (0.7 kb transcript); upstream gene is on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxnA	yxnA	4108148..4108206	-12.3	AAAAA<left>CCCAUGCUGUUC</left>CAGC<right>GAACCAUGGG</right>UUUUUCAGCUGUUAA	Northern blotting (1.1 kb transcript); upstream and downstream gene are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxaD	yxaD	4108163..4108220	-12.7	AAAAA<left>CCCAUGGUUC</left>GCUG<right>GAACAGCAUGGG</right>UUUUUCUUAUGGUCA	Northern blotting (0.6 kb transcript); upstream and downstream gene are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxaC	yxaC	4109922..4109973	-16.1	AGAAA<left>GACUGCCC</left>CGGGGGA<right>GGGCAGUC</right>UUUUUCGUUUAAGAA	Northern blotting (1.3 kb transcript); upstream and downstream genes are on the opposite strand	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxaA,yxaB	yxaAB	4109932..4109989	-18.9	AAAAA<left>GACUGCCCU</left>CCCCC<right>GGGGCAGUC</right>UUUCUUUGUUAAAUA	Northern blotting (2.4 kb transcript)	10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); SubtiList
gntR,gntK,gntP,gntZ	gntRKPZ	4117508..4117557	-14.2	AAAAA<left>CACGGUCAGU</left>UUCA<right>ACUGAACCGUG</right>UUUUUUUCUUCUAUC	S1 nuclease mapping; Northern blotting (5.5 kb transcript)	3020045 (Fujita et al., J. Biol. Chem. 1986, 261(29):13744-13753); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)	Main termination site, as determined by S1 nuclease mapping, is at position 4117549 (first T in the T stretch TTTTTTTCTT). Fujita et al. (3020045) show that two internal promoters exist, for unknown sigma factor, upstream of gntZ. Yoshida shows a monocistronic 2.0 kb gntZ transcript.
ahpC,ahpF	ahpCF	4120074..4120135	-24.0	AGAAA<left>UCCGCUAUAUUGCCA</left>GAU<right>UGGCAGGAUAGCGGA</right>UUUUUCUUUUUCUAC	Northern blotting (2.4 kb transcript)	8932314 (Antelmann et al., J. Bacteriol. 1996, 178(22):6571-6578); BSORF; SubtiList
yyzE,bglA	yyzE-bglA	4120138..4120188	-21.4	<left>UGGUGAGGAACUAUAAGAAGCGCUCG</left>AAU<right>CGAGCACUUUUACCGUAGUGCCUGGUUCG</right>GUUUUUUUCUGUAGAA	Northern blotting	BSORF; SubtiList
yydK	yydK	4123210..4123245	-7.6	AAUCC<left>AAUGAACUAC</left>UUUAUC<right>GUAUUCAUU</right>AUCUUUUUCCUCUUUGUA	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF
yydF,yydG,yydH,yydI,yydJ	yydFGHIJ	4123206..4123249	-13.8	AGGGA<left>GCUACUUCA</left>CAA<right>UGAAGUAGC</right>UUUUUAUGUGCACCU	Northern blotting	BSORF; SubtiList
fbp	fbp	4129352..4129431	-13.8	AAAAAAA<left>GUCCAUUCUA</left>UAUAACUCUCGC<right>UAGGGUGGAC</right>CUUUUUCAACAUUCAA	Northern blotting (2.4 kb transcript); upstream and downstream genes are on the opposite strand	9696785 (Fujita et al., J. Bacteriol. 1998, 180(16):4309-4313); BSORF	The putative terminator UGCUC<left>CCCUAAAAGUAGAUAGAU</left>GAAUUUUAGAAA<right>AUCUGUUUGCCUUGGGG</right>AGUUUUUUCAUGGCUGG (dG = -19.5 kcal/mole), located close to the stop codon, does not agree well with the Northern blotting result.
yycS	yycS	4134775..4134823	-17.4	AUAAA<left>GCCGGCGUUC</left>UGA<right>GAACGUCCGGC</right>UUUUUCUUUUACUUC	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF
yycR	yycR	4134785..4134833	-17.4	AAAAA<left>GCCGGACGUUC</left>UCA<right>GAACGCCGGC</right>UUUAUUGCUGGUAAU	Northern blotting	BSORF
yycO,yycP,yycQ	yycOPQ	4136347..4136391	-9.1	AUGAA<left>GAGACU</left>GGUGUGA<right>AGUCUC</right>UUUUUUUGUUGAACC	Northern blotting	BSORF	The Northern blotting result in BSORF suggests an mRNA transcript of about 2.2 kb, which would correspond to a yycOPQ transcript. The transcription map drawn in BSORF, however, shows a yycOP transcript; no Northern blotting experiment was done with a yycQ probe.
yycN	yycN	4138673..4138716	-10.1	AAAAG<left>GGCCU</left>GAUAA<right>AGGCC</right>UUUUUCUGUAAACGA	Northern blotting	BSORF
rapG,phrG	rapG-phrG	4140523..4140584	-12.9	AAGAA<left>UCCUAAAAC</left>GGUUUGUA<right>GUUUUAGGA</right>UUCUUUCAUCUUUUC	Northern blotting	11466295 (McQuade et al., J. Bacteriol. 2001, 183(16):4905-4909); BSORF	Internal promoter in front of phrG. Northern blotting results in BSORF show a rapG-phrG transcript and a shorter phrG transcript.
rocD,rocE,rocF	rocDEF	4140697..4140733	-10.3	AAACC<left>CCCGC</left>ACCC<right>GCGGG</right>UUUUCAGCGUGUCGA	translational fusion with lacZ; Northern blotting	7540694 (Gardan et al., J. Mol. Biol. 1995, 249(5):843-856); BSORF
rocR	rocR	4146501..4146548	-13.6	UUCAA<left>CUGAACGGG</left>CGUGACC<right>CCUGUUCAG</right>UUUUUUUUGCAUAUC	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF; SubtiList	
yycF,yycG,yycH,yycI,yycJ,yyxA	yycFGHIJ-yyxA	4146552..4146602	-17.6	AAAAG<left>CAGUCUGGCA</left>UCGU<right>UGCCAGGCUG</right>UUUUGAUAUGCAAAA	Northern blotting (7.4 kb transcript); transcriptional fusions	9829949 (Fabret & Hoch, J. Bacteriol. 1998, 180(23):6375-6383); 10878122 (Fukuchi et al., Microbiology 2000, 146(Pt.7):1573-1583); BSORF	Internal promoter in front of yyxA, leading to a 1.4 kb transcript. A shorter (2.4 kb) yycFG transcript was also detected.
purA	purA	4154411..4154451	-17.8	GUCUG<left>CAAGCCCCU</left>AUUUA<right>AGGGGCUUG</right>UUUUUUGUUUGAAAG	Northern blotting (1.40 kb transcript)	1312531 (Mantsala & Zalkin, J. Bacteriol. 1992, 174(6):1883-1890); 15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107)
dnaC	dnaC	4156462..4156502	-15.9	AUAAG<left>CCCCAAGAG</left>CUG<right>CUCUUGGGG</right>UUUUUUUCAUUCGAA	Northern blotting	BSORF
yycD	yycD	4158223..4158263	-12.1	GAAAG<left>CCUUCGC</left>UGCA<right>GCGAGGG</right>UUUUUUAGCGGUUAU	upstream and downstream gene are on the opposite strand	SubtiList
yycC,yycB	yycCB	4160017..4160052	-12.9	AUAAA<left>GCGGGGA</left>AGAUA<right>UCUCCGC</right>UUUUUUCUUUGAAUA	Northern blotting (1.4 kb transcript)	12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); SubtiList	Northern blotting results in BSORF show a yycB-yycA transcript and a monocistronic yycB transcript
yybS,yybT,rplI	yybST-rplI	4162181..4162230	-19.4	GAAAA<left>GAGGCUUGGA</left>UUCA<right>UCCAAGCCUC</right>UUUUUUUAUUCCACG	Northern blotting	BSORF	Northern blotting results in BSORF suggest the presence of an internal promoter in front of rplI
cotF	cotF	4166605..4166649	-21.7	AAACA<left>AGCAGCAAAGG</left>AGUUC<right>CCUUUGCUGCU</right>AUUUCUGCUGAUCCUU	Northern blotting; upstream and downstream genes are transcribed in the opposite direction	BSORF
yybR	yybR	4166611..4166663	-19.1	AAAUA<left>GCAGCAAAGGG</left>AAC<right>UCCUUUGCUGC</right>UUGUUUUAUUUCAUU	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF; SubtiList
ppaC	ppaC	4168144..4168194	-14.8	AAAAA<left>GCAUCCCG</left>CGU<right>CGGGAUGC</right>UUUUUCUUAUUCACC	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF; SubtiList
yybP	yybP	4168152..4168208	-14.8	AAAAA<left>GCAUCCCG</left>ACG<right>CGGGAUGC</right>UUUUUGCUUAUUCAG	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF
yybN,yybM,yybL,yybK,yybJ	yybNMLKJ	ND	ND	ND	Northern blotting	BSORF	Northern blotting results in BSORF suggest the existence of readthrough terminators after yybN and yybM. SubtiList shows a terminator GAAAAAATTTAG<left>AATGATAATCTT</left>TTTAT<right>AAGATTATCATT</right>TTTATTTATTCTATTA at position 4172616..4172672 downstream of yybN.
yybH,yybI	yybHI	4175858..4175912	-12.4	AAAAA<left>GAGUGCUU</left>UUCAGC<right>AAGCACUC</right>UUUAUUCCAGUUUAA	Northern blotting	BSORF
yybG	yybG	4178143..4178184	-8.3	AAAAA<left>GGACC</left>CGCUAAC<right>GGUCC</right>UUUUUUACUGAUCAA	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF
yybF	yybF	4178150..4178192	-8.8	AAAAA<left>GGACC</left>GUUAGCG<right>GGUCC</right>UUUUUUAUUUCCAAU	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF; SubtiList
yybE,yybD,yybC	yybEDC	4181478..4181523	-10.3	UCUGC<left>GGCAG</left>GCAG<right>CUGCC</right>AUUUUUUCUUUUUGGG	Northern blotting	BSORF; SubtiList
yyaT,yyaS	yyaTS	4184104..4184152	ND	ND	Northern blotting	BSORF
tetL,tetB	tetLB	4186237..4186289	-17.9	UGAAA<left>GGAUCAAUCUUGUGAAA</left>GUAA<right>UUCAAGGUUGAUCC</right>UUUUUUGUAAAAUGA	Northern blotting	BSORF	Northern blotting results in BSORF suggest the existence of an internal promoter in front of tetB
yyaO	yyaO	4188705..4188769	-13.8	UAAAA<left>CCUGUAAUCCGU</left>AACCAC<right>GCGGUAGCAGG</right>UUUUUUUAUUUGCUU	Northern blotting	BSORF; SubtiList
yyaL	yyaL	4192258..4192320	-22.0	AUUAA<left>UAAGCAGCAGGG</left>AUUAAGAC<right>CCUUGCUGCUUA</right>CUUUUUGAUUUCUUAU	Northern blotting; downstream gene is on the opposite strand	BSORF
yyaK	yyaK	4192268..4192327	-8.9	GAACA<left>CGGAAA</left>ACAUUG<right>UUUCCG</right>CUUUUUCGAUCAGUGA	Northern blotting; upstream and downstream gene are on the opposite strand	BSORF
exoA,ccpB	exoA-ccpB	4195788..4195816	ND	ND	Northern blotting	BSORF; 9457849 (Chauvaux et al., J. Bacteriol. 1998, 180(3):491-497); 10540738 (Shida et al., Biosci. Biotechnol. Biochem. 1999, 63(9):1528-1534)	Chauvaux et al. note that a ccpB-lacZ translational fusion was not expressed when only 183 nucleotides of upstream DNA were present, suggesting that ccpB is transcribed from a promoter further upstream. Chauvaux et al. propose an exoA-ccpB-yyaHI operon. Between exoA and ccpB, the potential terminator UAUAUGAUGAGAUA<left>GCAGUAAG</left>GAUUUUACA<right>CUUACUGC</right>UUUUUUUAUAUGAAA (dG = -12.5 kcal/mole) was found (SubtiList). Microarray data show a small probability (0.06 Bayesian probability) that exoA and ccpB are in the same operon. The Northern blotting results show a transcript of about 2.0 kb (BSORF), whereas exoA consists of 756 basepairs. However, the corresponding paper by Shida does not mention the inferred operon structure of exoA. The Northern blotting was performed with an exoA probe only.
yyaF,rpsF,ssb,rpsR	yyaF-rpsF-ssb-rpsR	4197579..4197633	-21.4	GUAAA<left>GAGCAAGGACC</left>UUCG<right>GGUUCUUGCUC</right>UUUUUUAUAGGGGGG	Northern blotting (2.4 kb transcript)	14762004 (Lindner et al., J. Bacteriol. 2004, 186(4):1097-1105)	Internal promoter in front of rpsF, leading to a 1.2 kb transcript. Northern blotting results in BSORF also show a yyaDEF-rpsF-ssb-rpsR transcript.
yyaC	yyaC	4204525..4204581	-9.3	AAAAA<left>CCAUCUUC</left>GUUU<right>GAAAGAUGG</right>UUUUUUCAUUUAUGA	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF
soj,spo0J	soj-spo0J	4204541..4204584	-10.9	AAAAA<left>CCAUCUUU</left>CAAAC<right>GAAGAUGG</right>UUUUUAUUUUAUAUG	Northern blotting	BSORF; SubtiList
yyaB	yyaB	4206886..4206930	-17.1	AAAAA<left>GCUCUCCUG</left>CUUUU<right>CAGGAGAGC</right>UUCUAUUUUGGUAUG	Northern blotting; upstream and downstream genes are on the opposite strand	BSORF
thdF,gidA,gidB,yyaA	thdF-gidAB-yyaA	4206884..4206925	-18.6	UAGAA<left>GCUCUCCUG</left>AAAAG<right>CAGGAGAGC</right>UUUUUAUAUUUUUAA	Northern blotting	11807071 (Sievers et al., J. Bacteriol. 2002, 184(4):1102-1111); BSORF; SubtiList	Internal promoter and possibly a readthrough terminator are located upstream of yyaA.
spoIIIJ,jag	spoIIIJ-jag	4212178..4212241	-17.6	UAAAA<left>CCGAAGUCCGAU</left>AAAA<right>AUUGGAUUUCGG</right>UUUUUUUGUAUCCGA	Northern blotting	1487728 (Errington et al., J. Gen. Microbiol. 1992, 138(Pt.12):2609-2618); BSORF; SubtiList	Northern blotting results in BSORF also indicate the presence of a rpmH-rnpA-spoIIIJ-jag transcript; Errington et al. also suggest that such longer transcripts may exist.
rpmH	rpmH	4214250..4214292	-16.1	GCUUA<left>GGCCACUGA</left>AUAAUG<right>UCAGUGGUC</right>UUUUUUCACGUUAUG	proposed	2987847 (Moriya et al., Nucleic Acids Res. 1985, 13(7):2251-2265)