Genes Operon name Terminator position Delta G [kcal/mole] Terminator Evidence References Comments
dnaA,dnaN dnaAN 3080..3115 -16.0 ACACUGCUGCCGACCCGUCGGCAGCUUUUCUAUUCGGUAU Northern blotting (2.9 kb transcript); transcriptional experiments 11395445 (Ogura et al., J. Bacteriol. 183(13):3833-3841, 2001); 2846289 (Moriya et al., EMBO J. 7(9):2911-2917, 1988); 2987847 (Moriya et al., Nucleic Acids Res. 1985, 13(7):2251-2265); BSORF Readthrough terminator downstream of dnaA, leading to a 1.7 kb transcript. The earlier result (Ogasawara et al., 2987848) showing an internal promoter in front of dnaN is incorrect (Ogura et al., 11395445; Ogasawara, personal communication). The Northern blotting experiments listed in BSORF suggest that readthrough may occur at the terminator downstream of dnaN.
yaaA,recF,yaaB,gyrB yaaA-recF-yaaB-gyrB 6775..6825 -14.4 AAAAAGCCUUAUUUCCAAUAAGAAAUAAGGCUUUUUUCUGAACAAG S1 nuclease experiments; transcriptional and expression experiments 2987848 (Ogasawara et al., Nucleic Acids Res. 1985, 13(7):2267-2279); 2987847 (Moriya et al., Nucleic Acids Res. 1985, 13(7):2251-2265) Internal promoter inside recF. Northern blotting results in BSORF show various transcripts in this region.
gyrA gyrA 9445..9495 -16.9 AAAAAGCGCAGCUGAAAUAGCUGCGCUUUUUUGUGUCAUAA S1 nuclease experiments; Northern blotting 2987847 (Moriya et al., Nucleic Acids Res. 1985, 13(7):2251-2265); BSORF BSORF shows various transcripts in the gyrA region, all terminating at the same position downstream of gyrA.
rrnO-16S,trnO-Ile,trnO-Ala,rrnO-23S,rrnO-5S rrnO-16S-trnO-Ile-trnO-Ala-rrnO-23S-rrnO-5S 14809..14843 -15.7 UUAAACCCAGCUCAAUGAGCUGGGUUUUUUGUUUGUUAA agrees with ribosomal RNA 5' sequence 6312418 (Ogasawara et al., Nucleic Acids Res. 1983, 11(18):6301-6318); 179998 (Sogin & Pace, J. Biol. Chem. 1976, 251(11):3480-3488)
guaB guaB 17385..17435 -15.7 CAUUUGACAGGGUCUCUGACUCUGUCUAUUUUUUUUAUACUGA Northern blotting BSORF
yaaD,yaaE yaaDE 20796..20845 -27.5 CGCGAGAGCUCUCGUCCCUUUAUGGGGAUGAGGGCUCUUUUUAUUUUCGAUA Northern blotting BSORF BSORF shows both a yaaDE transcript and a longer dacA-yaaDE-serS transcript
dgk,dck dgk-dck 22467..22510 -14.7 AAAAAGUGAAUCUCAGUCGAGAUUCACUUUUUCUUUAAAAUA Northern blotting; downstream genes are on the opposite strand BSORF
yaaH yaaH 23847..23897 -11.7 AAAAAGACGUUUCGAUAAUUUGGAAACGUCUUUUUUUCAUGGGGG Northern blotting (1.5 kb transcript) 10419957 (Kodama et al., J. Bacteriol. 1999, 181(15):4584-4591); BSORF
scr scr 26696..26735 -12.8 UCAGACUCACCUAAUAUUAGGUGAGUUUUUUGUUAUGUAA S1 mapping analysis of the 3' end 2468993 (Struck et al., Mol. Gen. Genet. 1989, 215(3):478-482) Northern blotting experiments listed in BSORF show various measured mRNA transcripts in the yaaJ-scr region. Struck et al. (1698458) find a promoter in front of yaaJ, upstream of scr, and suggest that transcription starting at this promoter continues into scr. The S1 nuclease mapping of the 3' end shows that transcription ends in the T-stretch of the indicated terminator structure.
bofA bofA 30069..30107 ND ND ND ND Northern blotting experiments listed in BSORF show a monocistronic bofA transcript and a longer transcript starting upstream of yaaK, terminating at the same position as the monocistronic transcript.
rrnA-16S,trnA-Ile,trnA-Ala,rrnA-23S,rrnA-5S rrnA-16S-trnA-Ile-trnA-Ala-rrnA-23S-rrnA-5S 35354..35388 -14.2 UUAAACCCAGCUUAAUGAGCUGGGUUUUUUGUUUACUCA proposed 6312418 (Ogasawara et al., Nucleic Acids Res. 1983, 11(18):6301-6318)
csfB csfB 35720..35745 -9.8 UCAUAGACCUGAAAAGGUCUUUUUUUGUACUCUU Northern blotting BSORF
xpaC,yaaN xpaC-yaaN ND ND ND Northern blotting BSORF
abrB abrB 44793..44855 -12.8 AAAAACGUUCUUGUUAUGACACAAGAACGUUUUUUUAUUGCUUA Northern blotting (0.4 kb transcript); upstream and downstream genes are on the opposite strand 3145384 (Perego et al., Mol. Microbiol. 2(6) 689-699, 1988); BSORF
metS metS 47618..47678 -13.4 CAAAAGGUGUUUCACGUGUAACAAUUCGUCGAACACCUUUUGUGUUUCGACA Northern blotting BSORF
yabE yabE 49947..49984 -14.8 GUAUUCAGAGGGUUUUGCGCCCUCUGUUUUUUUCGUUAUAA Northern blotting BSORF; SubtiList
rnmV,ksgA rnmV-ksgA 51492..51531 -10.4 AUAAAGCCCUUUUCUAAAAGGGCUUUUUGUUUUGCGCA Northern blotting 11233981 (Condon et al., RNA 2001, 7(2):242-253); BSORF
yabG yabG 52542..52594 -15.1 GAAAACCUGCAUAGGAGAGCUAUGCGGGUUUUUUAUUUUACAU Northern blotting (1.0 kb transcript) 10714992 (Takamatsu et al., J. Bacteriol. 2000, 182(7):1883-1888); BSORF
veg veg 53006..53056 -12.9 AACGGGCAGUGAACCUUUUGUUUACUGCUUUUUGUUUUGCCCU Northern blotting (0.3 kb transcript) 12761295 (Fukushima et al., J. Biochem. (Tokyo) 2003, 133(4):475-483); BSORF
sspF sspF 53370..53410 -16.6 GUGACCCGGGGGACGUGCUGUUCCCUGGUUUUUUUAUUUUGGA Northern blotting (0.3 kb transcript) 6205155 (Stephens et al., J. Mol. Biol. 1984, 176(3):333-348); 6790516 (Ollington & Losick, J. Bacteriol. 1981, 147(2):443-451)
purR,yabJ purR-yabJ 55657..55713 -15.5 GAAAAGUGAUUCUGGGAGAGCCGGGAUCACUUUUUUAUUUACCUU proposed 7638212 (Weng et al., Proc. Natl Acad. Sci. USA 1995, 92(16):7455-7459); SubtiList Northern blotting results listed in BSORF show a yabH-purR-yabJ, a purR-yabJ, and a yabJ transcript.
spoVG spoVG 56150..56222 -28.1 AGCAAGGACUGCUGAAAGGGCUGACAUAAGCCUUUUGCCGGCGGUCCUUUUUUAAUUCUGAU Northern blotting (0.4 kb transcript) 408013 (Segall & Losick, Cell 1977, 11(4):751-761); BSORF
gcaD,prs,ctc gcaD-prs-ctc 59380..59435 -13.4 CUUAAGGCGUAACCCUCCCGCGGUUACGUCUUUUGUGCUAGAAUG restriction endonuclease digestion 8522540 (Hilden et al., J. Bacteriol. 177(24): 7280-7284, 1995); 6273816 (Moran et al., Nucleic Acids Res. 9(22);5979-5990, 1981); 2836704 (Truitt et al., Mol. Gen. Genet. 212:166-171, 1988) The experiments show that gcaD, prs, ctc belong to the same operon, but do not show that genes further downstream do not belong to this operon. Truitt et al. propose that ctc and spoVC are in separate operons. Northern blotting results in BSORF show both a gcaD-prs-ctc transcript and longer transcripts. An internal promoter exists in front of ctc.
spoVT spoVT 64646..64702 -15.2 GUAAAGAACAGCUCUCCUUGGGACGCUGUUCUUUUUCAUGCGUGCC insertional mutant 8755877 (Bagyan et al., J. Bacteriol. 1996, 178(15):4500-4507) An extensive extensive screening for transcripts in the region from rrnO to spo0H by Asai et al. (11283287) revealed no transcripts containing spoVT and the downstream gene yabM. Transcription of the upstream mfd gene was found to continue into spoVT.
yabM,yabN,yabO,yabP,yabQ,divIC,yabR yabMNOPQ-divIC-yabR 70006..70070 -15.7 AUGAAGCAUCCGUUCAUCCCGACGGAUGCUUUUUUAUUAUCCUC Northern blotting (5.3 kb transcript) 11283287 (Asai et al., Microbiology 2001, 147(pt.4):919-927); SubtiList internal promoters in front of yabN (3.7 kb trancript), yabP (1.9 kb transcript), divIC (1.0 kb transcript), and yabR (0.5 kb transcript)
trnSL-Glu1 trnSL-Glu1 70333..70381 -13.9 ACAAAUCGGUUUCUCUUGCAGAAGCCGAUUUUUUUCAUUUUUA proposed 2832371 (Guzman et al., J. Bacteriol. 1988, 170(4):1598-1609)
spoIIE spoIIE ND ND ND ND ND
ftsH ftsH 78893..78945 -16.1 AAAAACUGCCGGCUGACGCUGGCAGUUUUUUUAUGUAAAU Northern blotting (2.1 kb transcript) 7608085 (Deuerling et al., J. Bacteriol. 1995, 177(14):4105-4112) Northern blotting experiments in BSORF also show two longer transcripts, starting from the upstream hprT and yacA genes.
cysK cysK 82677..82736 -15.6 CAAAACUCCCGGUUCGCCGGGAGUUUUUUUAUAUUUCG Northern blotting BSORF BSORF shows additional transcripts starting further upstream, but terminating at the same position.
pabB,pabA,pabC,sul,folB,folK,yazB,yacF,lysS pabBAC-sul-folBK-yazB-yacF-lysS 90213..90273 -25.3 AAAAAGAGCGGUAUCCUCCAUAGGGAAAGGAUGCCGCUCUUUUUAAAUCCCUUA Northern blotting (7.5 kb transcript) 9084182 (De Sazieu et al., Microbiology 1997, 143(Pt.3):979-989); BSORF readthrough terminators after pabA (undefined, resulting in a 2.1 kb transcript), after yacF (TTTGCTGCTCACTGCTAGTTTTACGCTGGCAGTTTTTCTGCTTTTTTCATGAA at 88645..88697, resulting in a 5.9 kb transcript); internal promoter in front of lysS, resulting in a 1.5 kb transcript.
rrnW-16S rrnW-16S 92131..92183 -17.2 GUUUAGUUUUGAAGGAUCAUUCCUUCGAAACGUGUUCUUUGAAAACUAG ND ND
ctsR,mcsA,mcsB,clpC,radA,yacK ctsR-mcsAB-clpC-radA-yacK 108555..108605 -4.4 UAAAACCUUAUGAAUACGGGUAUAUUAAUGUUGGUUUUUGUUUAUUCUG Northern blotting (7.0 kb transcript) and S1 nuclease mapping of the 3' end 8793870 (Kruger et al., Mol. Microbiol. 1996, 20(4):713-723) A ctsR-mcsAB-clpC transcript and various transcripts in the radA-yacKLMN region are listed in BSORF. The 3' nuclease mapping showed two weak termination signals in the AT-rich region at the end of a proposed terminator structure eight base pairs downstream of the stop codon (i.e., in the UUAAAA region in the left arm of the indicated stem-loop). However, mfold cannot detect such a stem-loop structure. Northern blotting results in BSORF show a ctsR-mcsAB-clpC transcript.
yacL,yacM,yacN yacLMN ND ND ND proposed 10482513 (Petersohn et al., J. Bacteriol. 1999, 181(18):5718-5724) Northern blotting results in BSORF show several transcripts in the radA-yacKLMN region, some terminating at yacM and others at yacN.
gltX,cysE,cysS,yazC,yacO,yacP gltX-cysES-yazC-yacOP ND ND ND extension analysis; Northern blotting; S1 nuclease mapping 7510287 (Gagnon et al., J. Biol. Chem. 1994, 269(10):7473-7482); 10024179 (Pelchat & Lapointe, RNA 1999, 5(2):281-289); BSORF terminator sequence GTCTGCTTTTCAAACAGAGTGGAACCGCGCGGTTAAAGCGTCTCTGTCATGTTTACATGCAGAGACGCTTTTTTTATTGGGTAGAGGAA at 112681..112770 downstream of gltX may represent an antiterminator; the gltX-cysES-yazC-yacOP transcript is rapidly processed to generate a gltX and a cysES-yazC-yacOP mRNA molecule. Northern blotting of gltX shows a 1.7 kb transcript. Gagnon and Pelchat assumes a gltX-cysES transcript, presumably because the yazC ORF was not known at the time. Northern blotting results in BSORF show a gltX, a gltX-cysES-yazC-yacOP, and a cysES-yazC-yacOP transcript.
sigH sigH ND ND ND ND ND
rpoB rpoB ND ND ND ND ND
ybaK,cwlD ybaK-cwlD 157296..157340 -13.3 GGAGACCCUCCGGAGUAAUGGAGGGUUUUCUUGUGGUUCU Northern blotting (1.2 kb transcript) 7559346 (Sekiguchi et al., J. Bacteriol. 1995, 177(19):5582-5589) Internal promoter in front of cwlD, leading to a 0.73 kb transcript.
gerD gerD 158475..158529 -17.6 AUAAAGGGAAAGCCGGGAUCUGGAAUCCCGGUUCACCUUUUAUACCUGCACU upstream and downstream genes are transcribed in the opposite direction 2517635 (Yon et al., J. Gen. Microbiol. 1989, 135(Pt.12):3431-3445)
ybaN ybaN 159610..159652 -5.0 CAAAUGUUUUCUUAGAGGACUGCUUUUGCUUUAUAUAA transcription upstream and downstream of ybaN proceeds in the opposite direction 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972) Dartois (8576055) notes that no transcriptional terminator could be found in the region between kbaA and ybaN.
rrnG-16S rrnG-16S 92131..92183 -17.2 GUUUAGUUUUGAAGGAUCAUUCCUUCGAAACGUGUUCUUUGAAAACUAG ND ND
feuA,feuB,feuC,ybbA feuABC-ybbA 179581..179632 -13.1 AAAAACCGCUCAACCCUAUGAGCGGUUUUUUUAUGCCUUC proposed; downstream genes are on the opposite strand 12354229 (Baichoo et al., Mol. Microbiol. 45(6):1613-1629, 2002)
ybbB ybbB ND ND ND proposed 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); SubtiList
trnSL-Glu2,trnSL-Val1,trnSL-Thr1,trnSL-Tyr1,trnSL-Gln2 trnSL-Glu2-trnSL-Val1-trnSL-Thr1-trnSL-Tyr1-trnSL-Gln2 194599..194644 -15.0 UCACAGACACCUUUGAUCAAAAGGUGUCUUUUUUCUUUUCGGA proposed 9683469 (Huang et al., J. Bacteriol. 1998, 180(15):3765-3770) possibility of readthrough cannot be excluded
sigW,ybbM sigW-ybbM 196024..196069 -16.2 GAGAAGAGUAAAGCGCGUUAGCCGCUUUGCUCUUUUUUUGCGGGCUG Northern blotting (1.2 kb transcript) 12207695 (Cao et al., Mol. Microbiol. 2002, 45(5):1267-1276); SubtiList Synonym: ybbM=rsiW
alkA alkA ND ND ND Northern blotting (1.5 kb transcript); upstream and downstream genes are on the opposite strand 8376346 (Morohoshi et al., J. Bacteriol. 175(18), 6010-6017, 1993); BSORF
adaA,adaB adaAB 205216..205272 -31.7 GUGAAGCCGACAAUUUUCAGGAUUCAAUGAUCUAACAUAAUCAUUGAAAUUUUGAAGUUGUCGGCUUUUUUGUUGGAAAA Northern blotting (1.6 kb transcript) 2120677 (Morohoshi et al., Nucleic Acids Res. 18(18) 5473-5480, 1990); BSORF Morohoshi proposes the terminator structure ATAAACTTGACAACTTTTAAAATTTAGCATATCTTAT at position 204936..204972; however, it is probably too weak to function as a terminator, and also does not agree with the 1600 bp mRNA found in the Northern blotting experiment (transcription start site is at position 203594).
ybcL ybcL 213025..213064 -14.3 UCUAACAUCCGCUCGUUAUACAAGCGGGUGUUUUUUUUAGCGUAG Northern blotting (1.2 kb transcript) BSORF; SubtiList
ybdK ybdK ND ND ND ND ND
ybdO ybdO 226224..226268 -15.2 UUAGGUAAGCUGUUCAUGUAGGACAGCUUAUUUUUUAUGAGAAUC Northern blotting (1.2 kb transcript) 15033535 (Serizawa et al., Gene 2004, 329:125-136); BSORF
ybxG ybxG 227929..227979 -10.6 AAAAAGAGACAUUCACGGAUGUCUCUUUUUUUAUUUUUCG proposed 9016963 (Shcheptov et al., Gene 1997, 184(1):133-140) The Northern blotting analysis listed in BSORF shows a 2.0 kb transcript, which corresponds to a ybxG-csgA-ybxH transcript.
csgA,ybxH csgA-ybxH 228566..228629 -19.2 AUUUAGAGCCCUGCCGUGCAGGGCUCUUUUAUUUAGGAUGU Northern blotting (0.6 kb transcript) 9016963 (Shcheptov et al., Gene 1997, 184(1):133-140) terminator is inside the coding region of the downstream gene ybxI, which is transcribed in the opposite direction. Subtilist proposes a different terminator TGAGATTTAGAGCCCTGCCGTGCAGGGCTCTTTTATTTAGGATGTAATC with dG = -18.3 kcal/mole, located immediately downstream of ybxH at position 228501..228549. However, the indicated stem-loop agrees better with the measured mRNA length (transcription start site is near position 228025).
ybxI ybxI 228500..228546 -5.5 GAUCCUGUUCAUUCUGGGCAUACUUAAUUUCUUUUUCU Northern blotting (0.8 kb transcript); upstream and downstream genes are on the opposite strand BSORF
cypC cypC 230757..230808 -15.6 AAAAAGCUCUCUUCCUUUAUCGAAGAGAGCUUUUUGAUUACUUCU Northern blotting (1.3 kb transcript); upstream and downstream gene are on the opposite strand BSORF; SubtiList
ybyB ybyB 230766..230823 -16.1 AAAAAGCUCUCUUCGAUAAAGGAAGAGAGCUUUUUAAUUUAACUU Northern blotting (0.3 kb transcript); upstream and downstream gene are on the opposite strand BSORF
ybeC ybeC 232940..233002 -15.9 GAAAACCUUGCGAUAGUUGUCGCAAGGUUUUUUGCUUUUAAU Northern blotting (1.6 kb transcript); upstream and downstream genes are on the opposite strand BSORF; SubtiList
glpT,glpQ glpTQ 232951..233003 -14.1 AAAAACCUUGCGACAACUAUCGCAAGGUUUUCUUCUAUAUUU Northern blotting (2.4 kb transcript) 8012593 (Nilsson et al., Microbiology 1994, 14(Pt.4):723-730); 10913081 (Antelmann et al, J. Bacteriol. 2000, 182(16):4478-4490) Internal promoter in front of glpQ, leading to a 1.1 kb transcript.
pssA,ybfM,psd pssA-ybfM-psd 249516..249565 -13.1 AAAAAGAGGAGCUUGCAUAAACGCAGCGCCUCUUUUUUUGAAGAAAG Northern blotting (1.9 kb transcript) 14762009 (Cao & Helmann, J. Bacteriol. 2004, 186(4):1136-1146) Matsumoto et al. (9422599, J. Bacteriol. 1998, 180(1):100-106) propose another terminator located inside ybfM at position 248249..248320: CTGGGAGATGGAATTAGTTCAGCAGCTCATAGCGGATTACGGTTATCTCGCTATTTTTTTGATGCTGGTATT
ybfO ybfO 251305..251343 -16.9 CGGUGUCCCCUGUGGUAAACAGGGGAUUUUUACAUAUCGCA proposed SubtiList
ybgB ybgB 258784..258834 -12.2 UCAAACAGCCAGAAUAAAACUGGCUGUUUUCUUUAAUUUCA ND ND
ybgE ybgE 260074..260116 -17.4 AAAAAGAACCUGCCCGGAGGCAGGUUCUUUUUAUUUUGAAUG Northern blotting (1.2 kb transcript) 15060025 (Mader et al., J. Bacteriol. 2004, 186(8):2240-2252)
ycbC,ycbD,ycbE,ycbF,ycbG,ycbH,ycbJ ycbCDEFGHJ 277026..277076 -19.5 CGAGACCCUCGUCCUUUGCAUAGGACGGGGGUUUUUUGUGUUUCUU Northern blotting (8.3 kb transcript) 12044674 (Hosoya et al., FEMS Microbiol. Lett. 2002, 210(2):193-199); SubtiList Internal promoter in front of ycbG, leading to a 2.3 kb ybcGH transcript. Measured mRNA transcripts suggest that readthrough terminators may exist behind ycbG and ycbH, leading to a 5.9 kb ybcCDEFG transcript, a 0.8 kb ybcG transcript, a 7.4 ybcCDEFGH transcript, and a 2.3 kb ybcGH transcript. Northern blotting results in BSORF various transcripts in this region.
yczA,ycbK yczA-ycbK 278289..278329 -2.7 UUACAAUAAGUGUAAUUACGUGUGUGUUUUUUGAUUUUGUA proposed 10706627 (Sarsero et al., Proc. Natl Acad. Sci. USA 2000, 97(6):2656-2661) Northern blotting results in BSORF show various transcripts in the yczA-ycbK region. Sarsero et al. suggest that yczA-ycbK may be part of a longer operon, since no clear terminator was found downstream of ycbK.
ycbL ycbL ND ND ND ND ND
cwlJ cwlJ 282421..282475 -15.1 CAGGACACCGUUCAAAUUGAACGGUGUUUUUCUUUGAAAAG Northern blotting (0.47 kb) 9515903 (Ishikawa et al., J. Bacteriol. 1998, 180(6):1375-1380); BSORF
ycbR ycbR 283267..283324 -17.5 AAGAGCACUGAGUCAUUCUGCGAAAUGGCUCGGUGUUUUUGCUUCUUUUU Northern blotting (1.2 kb and 1.4 kb transcripts) BSORF; SubtiList ycbR is shown as a monocistronic transcript in BSORF, however the indicated transcript lengths are not consistent with the 729 bp length of ycbR.
phoD phoD ND ND ND proposed 8760916 (Eder et al., Microbiology 1996, 142(Pt.8):2041-2047)
ycbU ycbU 288150..288205 -17.7 AAAAAGCCCCUGAACACUAGUCAGGGGCUUUUCAUAUUAAUGA Northern blotting (1.1 kb transcript); upstream and downstream genes are on the opposite strand BSORF; SubtiList
lmrA,lmrB lmrAB 288158..288216 -16.6 GAAAAGCCCCUGACUAGUGUUCAGGGGCUUUUUCAUGUUUACU Northern blotting (2.1 kb transcript) 15317768 (Yoshida et al., J. Bacteriol. 2004, 186(17):5640-5648); 12718394 (Murata et al., Can. J. Microbiol. 2003, 49(2):71-77) A 0.6 kb lmrA monocistronic transcript due to a readthrough terminator downstream of lmrA was also found.
yccC yccC 291583..291626 -11.0 GAAAAGAAGGCGAAUAAGCCUUCUUUUUUUUGGCUUUU proposed; upstream gene is on the opposite strand; the downstream lip gene was shown to be monocistronic in a Northern blotting experiment 11914346 (Fisher & Wray, J. Bacteriol. 2002, 184(8):2148-2154); SubtiList
lip lip 292397..292444 -15.8 CAAAACCUUGAAGAAUGCUAUUCUUCAAGGUUAUUCUGCUUUCAG Northern blotting (1.0 kb transcript); downstream gene is on the opposite strand BSORF; Genbank M74010
yccG yccG 294126..294178 -16.9 AAAAACCUUGAAAAGCCUGGCUUUUCAAGGUUUUUUCCAUUAUGA Northern blotting (1.0 kb transcript); downstream gene is on the opposite strand BSORF
yccH yccH ND ND ND Northern blotting (0.7 kb transcript) BSORF
natA,natB natAB 297869..297920 -9.8 CGAAAGGAGAAAUACACUUUCUCCUUUUUGUAUAUCCUG Northern blotting (2.0 kb transcript) 9106203 (Cheng et al., Mol. Microbiol. 1997, 23(6):1107-1120)
yccK yccK 298937..298994 -8.6 GGAAAUAGCCGUCAUGGCUAUUUCCUUUUGGUGUU Northern blotting (1.1 kb transcript); downstream gene is on the opposite strand BSORF; SubtiList
ycdA ycdA 298946..298999 -8.8 GGAAAUAGCCAUGACGGCUAUUUCCUUUUUUAUUU Northern blotting (0.9 kb transcript); upstream and downstream genes are on the opposite strand BSORF
ycdB ycdB 301871..301935 -19.4 AAAAGGACCUUUCUUCACUUUAAAUGAAGAAAGGUCUUUUUAUAUAAUAAA Northern blotting (1.8 kb transcript); upstream gene is on the opposite strand BSORF
rapJ rapJ 305096..305141 -17.4 AAAUGGCAGAGAACUACAGGUUCUCUGCUUUUUUUGUGCUGUU Northern blotting (1.0 kb transcript); upstream gene is on the opposite strand BSORF; SubtiList
ycdH,ycdI,yceA ycdHI-yceA 310376..310435 -16.4 GAAAAGCAGUUUUCCCUAGGGAAAACUGCUUUUUUUAUAGAAAC proposed 9811636 (Gaballa & Helmann, J. Bacteriol. 1998, 180(22):5815-5821) Northern blotting results in BSORF show a ycdHI (1.7 kb) and a yceA (0.9 kb) transcript.
yceC,yceD,yceE,yceF,yceG,yceH yceCDEFGH 317144..317209 -22.6 UAAAAACCCCGCUUGUGGAACAUAAGCGGGGUAUUUCAAUUACAUCAU proposed 11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457); SubtiList Northern blotting results in BSORF show various transcripts in this region.
yceK yceK ND ND ND Northern blotting (0.3 kb transcript); upstream gene is on the opposite strand BSORF
opuAA,opuAB,opuAC opuAABC 323547..323586 -15.4 AAAAAGCAGCCUGUGUCAGGCUGCUUUUUUUGCGUUAAG Northern blotting (3.0 kb transcript); genes further upstream or downstream are on the opposite strand 7622480 (Kempf & Brenner, J. Biol. Chem. 1995, 270(28):16701-16713); BSORF Northern blotting results in BSORF also show a shorter transcript at opuAC, but too short to represent a monocistronic transcript of the opuAC gene. Terminator is bidirectional.
amhX amhX 323552..323597 -15.4 AAAAAGCAGCCUGACACAGGCUGCUUUUUUGAUUACUUC Northern blotting (1.2 kb transcript); upstream and downstream genes are on the opposite strand 8768514 (Kempf & Brenner, FEMS Microbiol. Lett. 1996, 141(2-3):129-137); BSORF bidirectional terminator.
ycgA ycgA 326328..326363 -19.6 UUGCUGCCCGCCGGCUUGUACGGCGGGCUUUUGAGUUAUUCAU Northern blotting (1.2 kb transcript); upstream gene is on the opposite strand BSORF; SubtiList
ycgB ycgB ND ND ND Northern blotting (0.6 kb transcript) BSORF
amyE amyE 329168..329209 -12.9 CGAAAGAAACCAUCAAUGAUGGUUUCUUUUUUGUUCAUAAA Northern blotting (2.0 kb transcript) 11320136 (Pereira et al., Microbiology 147(5), 1331-1341, 2001); BSORF; SubtiList
ldh,lctP ldh-lctP 331939..331993 -19.6 AAAAAGCAGUACAUGCCCAGCAUGUACUGCUUUUUUUAUGUUAAU Northern blotting (2.7 kb transcript) 10809684 (Cruz Ramos et al., J. Bacteriol. 2000, 182(11):3072-3080) bidirectional terminator. BSORF lists a 2.6 kb and a 1.5 kb transcript, both hybridizing to the lctP probe.
mdr mdr 331949..332013 -19.6 AAAAAGCAGUACAUGCUGGGCAUGUACUGCUUUUUUCUAUUACAC Northern blotting (1.6 kb transcript) 9023234 (Ohki & Murata, J. Bacteriol. 1997, 179(4):1423-1427); BSORF; Genbank D50098 bidirectional terminator
ycgF,ycgG ycgFG 335641..335697 -7.9 CUGGCAGGGCGAUCUUUGUGACCCUACUUUUUUUGAUAGAUC downstream gene ycgH is in the opposite direction; no experimental evidence that ycgF and ycgG are in the same operon 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972) Northern blotting results in BSORF show a ycgEFG and a ycgG transcript.
ycgI ycgI ND ND ND Northern blotting (0.7 kb transcript) BSORF
nadE nadE 338659..338704 -17.4 AGAAAGCCCGCUCUCGGAGCGGGCUUUUGUCGUGUACAG proposed; downstream gene is on the opposite strand 2435704 (Albertini et al., J. Bacteriol. 1987, 169(4):1480-1484)
tmrB tmrB 338661..338708 -17.4 CAAAAGCCCGCUCCGAGAGCGGGCUUUCUUCAACUUAUU Northern blotting; upstream and downstream gene are on the opposite strand BSORF
aroK aroK 340126..340184 -16.2 AAAAAGCCGUGCGCAGCGCACGGCUUUUUUUAUCGUUUU Northern blotting; upstream and downstream gene are on the opposite strand BSORF
cah cah 343043..343097 -9.9 AAAAGCCGCCGCAUAUCAUCAGGCGGUUUUUUUCUGCAAAC Northern blotting (1.0 kb transcript) 7793942 (Mitsushima et al., Appl. Environ. Microbiol. 1995, 61(6):2224-2229); BSORF
ycgT ycgT 353578..353626 -6.0 AAGGGCUGCUUGCCAUCAGGUGUGAAGGAGUUUUUUCUCUGCAUG Northern blotting (1.4 kb transcript) BSORF
nasB,nasC,nasD,nasE,nasF nasBCDEF 353424..353463 -13.7 GCAAGCAGCCCUUUUCCUCAAGGGCUGUUUUAUUUAUGCACC Northern blotting (9.2 kb transcript) 7836289 (Nakano et al., J. Bacteriol. 1995, 177(3):573-579); 9765565 (Nakano et al., J. Bacteriol. 1998, 180(20):5344-5350); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165) internal promoter in front of nasD, leading to a 4.5 kb transcript
nasA nasA ND ND ND Northern blotting (1.3 kb transcript) 7836289 (Nakano et al., J. Bacteriol. 1995, 177(3):573-579); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); 7868621 (Ogawa et al., J. Bacteriol. 1995, 177(5):1409-1413) Ogawa proposes a putative terminator 150 bp downstream of nasA (sequence unknown); this doesn't agree well with the measured mRNA length (transcription start site is at position 362454).
yciA,yciB,yciC yciABC 366801..366849 -13.5 AAAAAGCCGUCCCAUGGGGAACGGCUUUUUUUAAUGAAAC downstream genes are on the opposite strand 9811636 (Gaballa & Helmann, J. Bacteriol. 1998, 180(22):5815-5821) Internal promoter in front of yciC.
yckC yckC 369212..369273 -13.5 AGAAAGAGCGAAUAAUGGUUCGCUCUUUUUAUUUUUAUGC Northern blotting (0.5 kb transcript) BSORF
yckE yckE 371239..371289 -18.3 AAGAGUCCCUGAGAGUUAUUCUCUCAGGGGUUUUUCAUUACACAG Northern blotting (1.5 kb transcript) BSORF; SubtiList bidirectional terminator. The Northern blotting experiments listed in BSORF also show a longer 2.4 kb transcript.
nucA,nin nucA-nin 371227..371293 -18.4 AAAACCCCUGAGAGAAUAACUCUCAGGGACUCUUUAUAAACUUUC proposed 7746143 (Van Sinderen et al., Mol. Microbiol. 1995, 15(2):213-223); 2841296 (Vosman et al., J. Bacteriol. 1988, 170(8):3703-3710) Bidirectional terminator. BSORF also shows monocistronic nucA and nin transcripts. Another terminator-like structure GUCAAUUGUCCAAUCCCAGUUGCUCGUUGUCAGAUGCGGAUUUUUUUUCGUUUUG (dG = -7.3 kcal/mole) was found at position 370828..370882 inside the coding region of the downstream gene yckE.
tlpC tlpC ND ND ND proposed 7746143 (Van Sinderen et al., Mol. Microbiol. 1995, 15(2):213-223); 7921238 (Hanlon et al., Microbiology 1994, 140(Pt.8): 1847-1854) Hanlon was not able to locate an obvious transcriptional terminator after tlpC, but notes that tlpC is probably monocistronic as the downstream gene nucA is specific for competence. Can Sinderen et al. suggest the terminator TGATTAATCAAGCCGAAAACGGCTGATGACTTACTATCATTATTG (dG = -9.0 kcal/mole) at position 372311..372355. BSORF does not contain a Northern blotting result for tlpC. The nucA-nin transcripts listed in BSORF start downstream of tlpC.
hxlA,hxlB hxlAB 374120..374166 -19.3 CACAACCGGCCUGAAGAUCAGGCCGGUUUUAUUUUUUCUAA Northern blotting (1.3 kb transcript found with hxlB probe; 1.5 kb transcript found with hxlA probe) 10572115 (Yasueda et al., J. Bacteriol. 1999, 181(23):7154-7160); 7921238 (Hanlon et al., Microbiology 1994, 140(Pt.8): 1847-1854); BSORF synonym: yckFG
hxlR hxlR 375937..375979 -12.0 UGUAAGACGCUCUUCGCAAGGGUGUCUUUUUUUGCCUUUUU Northern blotting (0.3 kb transcript) BSORF; SubtiList
srfAA,srfAB,comS,srfAC,srfAD srfAA-srfAB-comS-srfAC-srfAD 402679..402726 -17.9 CAAAAGCGGACAGCUUCGGCUGUUCCGCUUUUUUUGUGUUGAA lacZ insertions 8355609 (Cosmina et al., Mol. Microbiol. 1993, 8(5):821-831); 1715856 (Nakano et al., J. Bacteriol. 1991, 173(5):1770-1778) The lacZ insertions show that the length of the operon is at least 25 kb, which covers srfAA-srfAB-comS-srfAC.
ycxA ycxA 403996..404051 -16.0 UAAAAGGAUCAGCACUGUCAAUGCUGAUCCUUUUUAAAUUUGAGU Northern blotting (1.3 kb transcript) BSORF; SubtiList
ycxC,ycxB ycxCB 404009..404067 -18.1 AAAAAGGAUCAGCAUUGACAGUGCUGAUCCUUUUAUAUUGAAUGG Northern blotting (1.6 kb transcript) BSORF Northern blotting results in BSORF suggests the existence of an internal promoter in front of ycxB, leading to a 0.6 kb transcript.
yczE yczE 407784..407831 -11.9 UAAAACAAAGCCGCCUUGGCUUUGUUUUUUUAUUUUCUC Northern blotting (0.65 kb transcript) BSORF
yckK,yckJ,yckI yckKJI 408695..408751 -16.4 CAAAAUCCUAAAACGAUAUUCGUUUUAGGAUUUUGUGAUUUUCAG Northern blotting (2.3 kb transcript) 15262924 (Burguiere et al., J. Bacteriol. 2004, 186(15):4875-4884); BSORF SubtiList suggests the terminator GTTTGCCAACACGCTGAAACAGGGCGCCTGCGCGCCTGTTTTTTTGTTGAGCCCCTTTCGCCTATT (dG = -16.8 kcal/mole) at position 408524..408589, 198 basepairs downstream of the stop codon. However, the indicated terminator (found by mfold; located 34 basepairs downstream of the stop codon) agrees better with the Northern blotting experiment listed in BSORF, which showed a 2.3 kb transcript.
yclE yclE 415760..415804 -20.1 AAAAACAGCCCGCAGAUCAACAUCCGCGGGCUGUUUCUGAUUAUAAGA Northern blotting (0.8 kb transcript) BSORF
yclF yclF 415760..415811 -25.2 AGAAACAGCCCGCGGAUGUUGAUCUGCGGGCUGUUUUUUAUUGAUCAA upstream and downstream genes are on the opposite strand SubtiList
rapC,phrC rapC-phrC 429635..429693 -18.1 ACAAGCCCCUUCUCAUUAGCGAGAAGGGGUUUUUCUUUUCAAAA transcriptional fusions; downstream gene is in the opposite direction 1702397 (Carter et al., Gene 1990, 96:101-105); 10464187 (Lazazzera et al., J. Bacteriol. 1999, 181(17):5193-5200) internal promoter in front of phrC. Northern blotting results in BSORF show various transcripts in this region.
yclM yclM 430144..430187 -19.1 AUAAAUAGCGGGCGGCAGCGCCCGCUAUUUUUUUAUAUCACC Northern blotting (1.5 kb transcript); upstream and downstream genes are on the opposite strand BSORF; SubtiList
yclN,yclO,yclP,yclQ yclNOPQ 435546..435601 -19.1 AAAAAGAGCCUCCGCUAAAUAGCGGGGCUCUUUUUUUGUUAAUCA proposed 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); SubtiList Northern blotting results in BSORF show a yclNOPQ (3.6 kb), a yclOPQ (2.6 kb), a yclPQ (1.7 kb), and a yclQ (1.0 kb) transcript.
ycnC,ycnB ycnCB 435558..435613 -21.2 AAAAAGAGCCCCGCUAUUUAGCGGAGGCUCUUUUUGGUUUUACUU Northern blotting (2.4 kb) BSORF
ycnE,ycnD ycnED 438041..438086 -22.9 UAUUCGGCCUGUCGGAUUUUCCGGCAGGCCUUUCAUUUACCCGGU Northern blotting (1.1 kb transcript) BSORF
yczG yczG 439580..439623 -10.0 AUCAAUCCCCUGUAACGGGGAUUUUUUUAUGUCCGU Northern blotting BSORF
gabR gabR 439384..439430 -11.9 AUUUGGCAACCUGCACAUCUGCACAGGUGCUGCACGUUUUUUCUUUUGCUU ND ND
gabT,gabD gabTD 443918..443958 -24.2 CCUGAGAGCUGCCGGAUUUUCCGGCAGCUCUUUUUGUGUUCCGGC lacZ gene fusion to gabT and gabTD; 5' primer extension analysis of the downstream glcU-gdh operon; Northern blotting (2.6 kb transcript) 12123465 (Belitsky et al., Mol. Microbiol. 2002, 45(2):569-583); BSORF The lacZ fusions showed that an internal promoter (sigma factor unknown) exists between gabT and gabD). The Northern blotting results in BSORF only showed the gabTD transcript.
glcU,gdh glcU-gdh 445694..445743 -14.3 AAAAAGCGACCCAGACAUGACAUCUGGAUCGCUUUCUUUAUUAGGCA 5' primer extension analysis of gdh; genes downstream of gdh are on the opposite strand; Northern blotting (1.6 kb transcript) 3141376 (Rather & Moran, J. Bacteriol. 1988, 170(11):5086-5092); 3082854 (Lampel et al., J. Bacteriol. 1986, 166(1):238-243); 2493633 (Nakatani et al., Nucleic Acids Res. 1989, 17(3):999-1017); BSORF Northern blotting experiment described by B. Uratani, K.A. Lampel, R.H. Lipsky, E. Freese, in "Molecular Biology of Microbial Differentiation", edited by J.A. Hoch & P. Setlow, American Society for Microbiology, Washington DC, pp. 71-76 (1985). BSORF also shows a glcU-gdh Northern blotting result.
ycnL ycnL 449092..449140 -16.2 GAAAAGGCUCCUGAAACCAGGAGCCUUUUUAUUUUUAAAA Northern blotting (0.35 kb transcript) BSORF
mtlA,mtlD mtlAD 452289..452330 -17.7 GACCACCCGUGACACAAUGUCACGGGCUUUUUUUACUAUCUC Northern blotting (3.0 kb transcript) 12897001 (Watanabe et al., J. Bacteriol. 2003, 185(16):4816-4824); BSORF; SubtiList
ycsA ycsA ND -26.3 UCUGAUGAAUCAGGCCGGUGGCAGAUGGCUGCCCCGGUCUGUCCAUUUCCUUACGAAAAU Northern blotting (0.9 kb transcript) BSORF
sipU sipU 454206..454263 -14.2 UGAAACGGUGCGGAGCCGGCUUUCCGCCCCGUUUUUUAUGAUAGAA Northern blotting (0.6 kb transcript); downstream gene is on the opposite strand BSORF; SubtiList
yczH yczH ND ND ND Northern blotting (0.4 kb and 0.6 kb transcripts) BSORF
ycsD ycsD 455293..455331 -19.9 AAAAAAACCCUUCACAACAUUUUGUGAGGGGUUCUAUUUUGUGUCGUAAUC Northern blotting (0.5 kb transcript) BSORF
ycsE ycsE 456361..456407 -14.9 AAAAAGAGAGUCCUAAGAUGGACUCUCUUUUUAGUUUGGCAG Northern blotting (0.8 kb transcript) BSORF; SubtiList
ycsF,ycsG,ycsI,kipI,kipA,kipR,ycsK ycsFGI-kipIAR-ycsK 462613..462663 -14.1 GAAAACGCGCCUCAUGACAGGCGCGUUUUUUAUGUGUGAU proposed 9334321 (Wang et al., Genes Dev. 1997, 11(19):2569-2579); SubtiList Northern blotting results in BSORF show a monocistronic ycsF transcript (0.65 kb), a ycsGI-kipIAR transcript (4.5 kb), and a monocistronic ycsK transcript (0.65 kb).
yczI yczI ND ND ND Northern blotting (0.25 kb transcript) BSORF
yczJ yczJ 462625..462682 -10.4 CAAAAACGGCGGUAUAAAUAUUAAAAGCGCCUGAGCCGUCAUUUUCUUUUUUGCGC Northern blotting (0.3 kb transcript) BSORF
mtlR mtlR 468769..468812 -15.2 CAUGGCACACGUCAAAAAUUUGGCGUGUGUUUUUCUGUGGAUGG Northern blotting (2.1 kb transcript) 12897001 (Watanabe et al., J. Bacteriol. 2003, 185(16):4816-4824) Northern blotting results in BSORF show a ycsN and a ycsN-mtlR transcript.
ydaD,ydaE,ydaF,ydaG ydaDEFG 474152..474209 -15.3 ACAAACCGCCCGGCGUACGCCGGACGGUUUUUUUAUUGCAAA Northern blotting (2.8 kb and 3.3 kb transcripts) 10220166 (Petersohn et al., Microbiology 1999, 145(Pt.4):869-880) A readthrough terminator TTTACCGATCCAAGAATATAAGGATGGCTTAACAGCCCATCCTTTTTGTATTGAAAAAA with dG = -11.6 kcal/mole at position 472626..472684 downstream of ydaE leads to a 1.6 kb transcript. Both ydaDEFG transcripts terminate before reaching ydaH. An internal promoter in front of ydaG leads to monocistronic ydaG transcripts of 0.47 kb, 0.6 kb, and 0.9 kb. A 1.6 kb ydaFG transcript was also detected.
lrpC lrpC ND ND ND proposed 9341680 (Beloin et al., Mol. Gen. Genet. 1997, 256(1):63-71) Genbank AB001488 lists no terminator for lrpC. The terminator ACGGGCGCGGUUAGAGAGUGCCGCGCGAAGUCUGUUAU (dG = -16.0 kcal/mole) at 476037..476074, suggested by Beloin, lacks a T-stretch.
ydaP ydaP 490097..490149 -14.4 AAAAAACAGGGGCCCUAAGAGCCCUUGUUUUUUUUUUUUUUUU Northern blotting (1.8 kb transcript) 10220166 (Petersohn et al., Microbiology 1999, 145(Pt.4):869-880)
ydaT,ydaS ydaTS 492158..492205 -17.7 CAGGAGGCAUCGUUUCGAAAUGAAACGAUGUCUUUUUAUAUGGGACC proposed 10482513 (Petersohn et al., J. Bacteriol. 1999, 181(18):5718-5724)
ydbA ydbA 493919..493971 -11.5 AGAAAGCAGACGGACACCGCGAUCCGCCUGCUUUUUUUAGUGGAAA primer extension of downstream gsiB gene 1378051 (Mueller et al., J. Bacteriol. 1992, 174(13):4361-4373)
gsiB gsiB 494452..494503 -20.7 AAAAAGCGAUCCGGCACAUCAGCUGGAUCGCUUUUUUUUGGAAUCU hybrid formation with RNA probes 1378051 (Mueller et al., J. Bacteriol. 1992, 174(13):4361-4373)
dctB,ydbD dctB-ydbD 495257..495297 -16.7 GACAAGCCCAAAACAUGAUGUUUUGGGCUUUGAUUAUGCCUUC Northern blotting (2.0 kb transcript) 10708364 (Asai et al., Microbiology 2000, 146(Pt.2):263-271); Genbank AB001488
dctS,dctR,dctP dctSRP 500983..501029 -14.7 AAGAACGGCCCAUCCAUGGGCCGUUUUUUUAAUUGUUU Northern blotting (3.8 kb transcript) 10708364 (Asai et al., Microbiology 2000, 146(Pt.2):263-271); Genbank AB001488 internal promoter in front of dctP, leading to a 1.3 kb transcript
ydbN ydbN 505858..505903 -10.1 AAAAAGAGCCGGUAAGGCUCUUUUUUUUAUGACUC upstream and downstream gene are on the opposite strand 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); Genbank AB001488
ydbO ydbO 507323..507389 -20.1 AAAUUCAGUCACUUCUUCAGGCGUUUUGGCAUUGGCGCUGUGAAGGUGAGCUGUUUUUUCACCGUUCU upstream and downstream genes are on the opposite strand ND
ydbP ydbP 507234..507286 -16.5 AUGAACAUGAACAUGAGUGACAUCGUGUUCAUGUUUUAUUUUGUCUUC ND ND
ydbS,ydbT ydbST 514558..514598 -19.1 UCUGAAGCGGCGGUUAAUACCGCCGCUCUUUUUUUUGCACGCA downstream gene is on the opposite strand 11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457); SubtiList no experimental evidence that ydbS and ydbT belong to the same operon; Genbank AB001488 does not list a terminator after ydbT
ydcA ydcA 3106076..3106128 -13.8 CAAAAUCCUAAAAUGGUUUUCAUUUUAGGAUUUUGUCAUCUUUUC upstream and downstream genes are transcribed in the opposite direction 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972) No terminator listed in Genbank AB001488
ydcC ydcC 516813..516856 -11.5 CCAAAGGCCAAACAUGAUUUGGCCUUUUUUUCGUUAGAC proposed Genbank AB001488
ydcE ydcE 518856..518897 -11.8 UGCAGGUUGCUCAAAUAGAGCAACUUUUUUUGUUUUCAA proposed 8002610 (Wise & Price, J. Bacteriol. 1995, 177(1):123-133)
rsbR,rsbS,rsbT,rsbU,rsbV,rsbW,sigB,rsbX rsbRSTUVW-sigB-rsbX 523799..523851 -13.5 AAAAAGAAGCUGGACAUCCGGCUUCUUUUUUUUGCGGUUG S1 nuclease mapping of 3' end; lacZ fusion to rsbV; the promoter in front of rsbR was the only promoter detected in the rsbRSTU region 2170324 (Kalman et al., J. Bacteriol. 1990, 172(10):5575-5585); 8002610 (Wise & Price, J. Bacteriol. 1995, 177(1):123-133) The S1 nuclease mapping showed that transcription ends in the T-stretch of the indicated terminator (positions 523844..523849). Internal promoter in front of rsbV.
phrI phrI 548129..548179 -13.1 AAAAAGCUUAAUCUUUUUUCGAAGGUUAAGCUUUUUCUUUUAUUUA proposed 11466295 (McQuade et al., J. Bacteriol. 2001, 183(16):4905-4909); Genbank AB001488
nap nap 591748..591791 -12.9 AAAAAUAGAGUCCCUCUUAUGGACUCUAUUUUUCUUGGACAAA Northern blotting (0.9 kb transcript); downstream genes are on the opposite strand 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
ydfK ydfK 592901..592941 -7.1 AGCGGCUCCACAAAGGAGGUUAAUAUUCUGUUAU ND ND
ydfO ydfO ND ND ND ND ND
dinB dinB 607759..607802 -17.8 AAAAAGCGGCUCCCUAAAUGGAGCCGCUUUUUUCGGGAAAUA proposed 1847907 (Cheo et al., J. Bacteriol. 1991, 173(5):1696-1703); SubtiList
ydhD ydhD ND ND ND Northern blotting (1.3 kb transcript) 11011148 (Kodama et al., J. Biochem. (Tokyo) 2000, 128(4):655-663)
phoB,ydhF phoB-ydhF 618823..618874 -22.2 AUCAAGAACUCCCGUACAAGGUACGGGAGUUCUUUUUCUUAUUUGUU Northern blotting (2.2 kb transcript) 10913081 (Antelmann et al, J. Bacteriol. 2000, 182(16):4478-4490)
ydhK ydhK 624642..624690 -13.2 AAAAAUCCUCCUUUUACAAGGAGGAUUUUUUUGCUGUUUG ND ND
ydhU ydhU 633424..633474 -20.9 GGGAAGGUGCUCAAGAAACUUCUUGAGCACCUUCUUAAUUGUGACA upstream and downstream coding regions are on the opposite strand 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); Genbank AB001488
groES,groEL groESL 651651..651699 -20.0 GAGAAGGUCUUUCAUCAGUUUACUAAACUGUUGGGAGACCUUUUCUCCAUAUUAG Northern blotting (2.1 kb transcript) 1350776 (Li & Wong, J. Bacteriol. 1992, 174(12):3981-3992) Oshima (11751814) finds a 7.6 kb groESL-ydiNOP readthrough transcript induced by heat treatment.
ydiO,ydiP ydiOP 657268..657342 -18.2 AGUAUCGGAGCUGGAUAAAACCAGCUCCGUUUUUUAUCUUUAAU Northern blotting (3.0 kb transcript) 11751814 (Ohshima et al., J. Bacteriol. 2002, 184(2):381-389); Genbank AB007637 The measured length of the mRNA transcript suggests that the upstream ydiN gene also belongs to this operon. No hybridization with a ydiN probe was attempted. Another potential terminator AACAUUUGACUGUGGAAGGCCCAUGAGUUCCUCAGGGCCUUCCACAGUCUCUCGAUU (dG = -38.9 kcal/mole) was found at position 657495..657551 further downstream.
ydiR,ydiS,ydjA ydiRS-ydjA ND ND ND Northern blotting (4.0 kb transcript) 11751814 (Ohshima et al., J. Bacteriol. 2002, 184(2):381-389)
ydjC ydjC 664232..664277 -16.4 CGAAAGGCCAACUGCGACUUCAGUUGGCCUUUCCUAUUUAUAAU proposed; downstream gene is on the opposite strand Genbank AB007637 bidirectional terminator
gutR gutR 664237..664286 -18.0 GGAAAGGCCAACUGAAGUCGCAGUUGGCCUUUCGUUUCUUAUUA Northern blotting (2.8 kb transcript); upstream and downstream genes are on the opposite strand 12897001 (Watanabe et al., J. Bacteriol. 2003, 185(16):4816-4824); Genbank AB007637 bidirectional terminator
gutB,gutP gutBP ND ND ND Northern blotting (2.5 kb transcript) 12897001 (Watanabe et al., J. Bacteriol. 2003, 185(16):4816-4824)
pspA,ydjG,ydjH,ydjI pspA-ydjGHI 674329..674385 -15.0 GAAAAGUCCGGAGUGAUCAGCACUCGGGACUUUUUUAUUUAGGAG Northern blotting (3.6 kb transcript) 15033535 (Serizawa et al., Gene 2004, 329:125-136); 11454200 (Wiegert et al., Mol. Microbiol. 2001, 41(1):59-71); 9455482 (Kasahara et al., DNA Res. 1997, 4(5):335-339) Bidirectional terminator. A readthrough terminator TACATAGGAGGCCGCAGCTTTCGGCTGCGGCGTCATTTTATCATAAAATGTGAGAGGG was found downstream of pspA at 671646..671703, leading to a 0.7 kb transcript.
ydjJ ydjJ 674321..674400 -13.5 AAAAAGUCCCGAGUGCUGAUCACUCCGGACUUUUCACUGUAUGAU proposed; upstream and downstream gene are on the opposite strand Genbank AB007638 bidirectional terminator
ydjK ydjK 677403..677453 -13.4 AAGAAUCCGCACCCGAGUGCGGAUUCUUUUUGGUUUCA Northern blotting (1.7 kb transcript) 11807058 (Yoshida et al., J. Bacteriol. 2002, 184(4):983-991); Genbank AB007638 Bidirectional terminator. ydjK synonym is iolT
ydjL ydjL 677415..677470 -18.7 AAAAAGAAUCCGCACUCGGGUGCGGAUUCUUUUUUAAAUUAUCC proposed; upstream and downstream gene are on the opposite strand Genbank AB007638 bidirectional terminator
ydjM ydjM 679311..679359 -10.2 GGAAAGCAAGAAGUCACAUUCUUGCUUUUUCUAUUGGUGG proposed Genbank AB007638
yeaA,ydjP,ydjO yeaA-ydjP-ydjO ND ND ND proposed; downstream gene is on the opposite strand 9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371)
cotA cotA 682972..683024 -11.3 ACAAACUUGCCUCUAGCAGGCAAGUUUUUUCUUUAUGAA proposed Genbank AB007638
gabP gabP 684656..684708 -15.7 UCAAAUCCUAAACGGCCUGCCGUUUAGGAUUUUGUUAUUUUCUU proposed 8951816 (Ferson et al., Mol. Microbiol. 1996, 22(4):693-701); Genbank U51115
guaA guaA 693630..693688 -24.1 GGAAACCAUCUUUUUGGCAAUUUUGCCGGGAAGAUGGUUUUAUUUGUUUAUU proposed 1312531 (Mantsala & Zalkin, J. Bacteriol. 1992, 174(6):1883-1890)
pbuG pbuG 695325..695376 -17.3 AAAAACCAGCUGCACUGGCAGCUGGUUUUUUUUGUUGCAA proposed 12923093 (Johansen et al., J. Bacteriol. 2003, 185(17):5200-5209); Genbank U51115
purE,purK,purB,purC,purS,purQ,purL,purF,purM,purN,purH,purD purEKBCSQLFMNHD 710747..710792 -15.1 GAAAACCCGCAGAAUAGCUGCGGGUUUUUUGUUAUCAAA S1 nuclease mapping of 3' end (transcript ends at the T at position 710789); Northern blotting (12.8 kb transcript) 3036807 (Ebbole & Zalkin, J. Biol. Chem. 1987, 262(17):8274-8287); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
sapB sapB 725339..725386 -19.3 UAAAAGCCAAUGGGACUGGAAUCCCAUUGGCUUUUUCUAUCUACAC proposed 9043134 (Whalen & Piggot, Microbiology 1997, 143(Pt.2):577-583)
opuE opuE 726142..726188 -17.2 AAUAAGCCAUCAAGCGCAGCUUGGUGGCUUUUGUGCUCUUGUU Northern blotting (1.6 kb transcript) 9701821 (Spiegelhalter & Bremer, Mol. Microbiol. 1998, 29(1):285-296); 11902719 (Von Blohn et al., Mol. Microbiol. 1997, 25(1):175-187); 9043134 (Whalen & Piggot, Microbiology 1997, 143(Pt.2):577-583) readthrough into downstream sapB, leading to a 2.4 kb transcript.
rapH rapH 751556..751604 -8.8 AGAAAGCCCUUAGCUAGGGCUUUUUCUUGCUUUAC proposed SubtiList
yesE,yesF yesEF 755113..755155 -16.3 AGAAAGACCUUCGGCGCUUCCGAAGGUCUUCUUAUUGAAAAAG proposed 7768848 (Henriques et al., J. Bacteriol. 1995, 177(12):3394-3406)
cotJA,cotJB,cotJC,yesJ,yesK cotJABC-yesJK ND ND ND Northern blotting (1.9 kb transcript) 7768848 (Henriques et al., J. Bacteriol. 1995, 177(12):3394-3406); 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165) Northern blotting experiment by Yoshida. Eichenberger proposes a cotJABC-yesJ transcript, Henriques a cotJABC transcript.
yfnI yfnI 797564..797621 -30.0 AAAAAGAGCCUUGAGCGGGCGCAUUGCCUUCGCUCAAGGCUCUUUUUUUGGUUAUAC Northern blotting BSORF; Genbank D86418
yfnH,yfnG,yfnF,yfnE,yfnD yfnHGFED 802612..802654 -18.6 AAAACCCCCUGCCGCCUGGCAGGGGUUUUUUCAGCUAUGC Northern blotting BSORF; Genbank D86418 bidirectional terminator
yfnC yfnC 802619..802662 -20.6 AAAAACCCCUGCCAGGCGGCAGGGGGUUUUUUAAUCCAGCU Northern blotting BSORF; Genbank D86418 bidirectional terminator
yfnB yfnB 803973..804020 -22.2 GAAAAUACCGUCAGCUGCUAAUCAGGCUGACGGUAUUUCUUUCAUAAGAA Northern blotting BSORF; Genbank D86418
yfnA yfnA 804746..804804 -19.0 UUUCAGCCGGCGGUGCCUCACCCGCCGGCUUUUUCCUUUUUUUA Northern blotting BSORF
yfmT,yfmS yfmTS 808736..808795 -19.6 UAAGAGACCGGGGACAAACAUCCCCGGUCUUUUUCUUAUCCUGC Northern blotting (2.4 kb transcript) 15033535 (Serizawa et al., Gene 2004, 329:125-136); 9141694 (Yamamoto et al., Microbiology 1997, 143(Pt.4):1317-1320); BSORF
yfmR yfmR 810775..810815 -18.1 AAAAAGCGUGGCCGCAGCAGGCCGCGCUUUUUUUCACAUAAU Northern blotting BSORF; Genbank D86418
yfmQ yfmQ 811360..811406 -12.4 UGAAAGACGGGUGCUGUAUGCUGCUCGUCUUUUUUAUUGUUUUU Northern blotting BSORF; SubtiList
yfmP,yfmO yfmPO 813145..813192 -15.5 CGAAAGACACUGCGCAUAUGCAGUGUCUUUUUAUUCGUUAUA proposed 14663075 (Gaballa et al., Microbiology 2003, 149(Pt.12):3413-3421); SubtiList Northern blotting results in BSORF show a yfmP, a yfmO, and a yfmPO transcript. Genbank D86418 and SubtiList show a terminator AAAAGTTTGTTAAACGCTATTTTTGTAGCGTTTCTTTTAATGGAATAAAGATGGAGGTTAG between yfmP and yfmO at 811899..811959.
yfmM yfmM 813670..813730 -16.4 AAAAACCCGCCUGCUAAAGGGCGGGUUUUUUACUGCCAUU Northern blotting BSORF; Genbank D86417
yfmL yfmL 816561..816609 -8.7 AAGAAGGGCGAAGAGCCCUUUUUUUGUUGUAAA Northern blotting BSORF; Genbank D86417
yfmK yfmK 817103..817147 -17.0 CAAAAGGAGGGCAAAAAGCCCUCCCGUUUUCAUCUUCAUUC Northern blotting BSORF; Genbank D86417
yfmI,yfmJ yfmIJ 816779..816843 -15.7 AAACGGGAGGGCUUUUUGCCCUCCUUUUGUGUUUCGAUG Northern blotting BSORF The Northern blotting results in BSORF suggest the existence of an internal promoter in front of yfmJ.
yfmH yfmH ND ND ND Northern blotting BSORF
yfmG yfmG 821716..821764 -19.2 UUCAGCUUGUAGAAAAAACAAUGUUUUUUCUACAAGAUUUUAUUUUAAAUGC Northern blotting BSORF; Genbank D86417
yfmD,yfmE,yfmF yfmDEF ND ND ND Northern blotting BSORF Northern blotting results in BSORF show the following transcripts in this region: yfmDEF, yfmCDEF, yfmC, yfmBC, yfmB
yfmC,yfmD yfmCD ND ND ND proposed 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629) Northern blotting results in BSORF show the following transcripts in this region: yfmDEF, yfmCDEF, yfmC, yfmBC, yfmB
yflT yflT 827135..827185 -8.4 CAAAAGGCCAAUGUCGGCCUUUUGGUUUUUUUGC Northern blotting BSORF; Genbank D86417
pel pel 828581..828636 -12.4 AAAAACACAAAGGGUGCUAACCUUUGUGUUUUUUAAUUAAUUA Northern blotting (1.3 kb transcript) 8262178 (Nasser et al., FEBS Lett. 1993, 335(3):319-326); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); SubtiList Northern blotting results in BSORF also show a pel-yflS trancript.
yflS yflS 830143..830193 -12.6 AAAAAGGCAGACGCGGUCUGCCUUUUUUUAUUUUCAC Northern blotting (1.45 kb transcript) 12949159 (Tanaka et al., Microbiology 2003, 149(Pt.9):2317-2329); Genbank D86417 Northern blotting results in BSORF also show a pel-yflS trancript.
citS,citT,yflP citST-yflP 833501..833552 -8.9 UAAAAUCCCGACAUCCCGGGAUUUUUUUCAUGCCGA Northern blotting BSORF Yamamoto et al. (10972810) propose a citST operon.
citM,yflN citM-yflN 835855..835899 -15.8 UUUGACACCCGCACCACGCGGGUGUUUUUUAUUGUUUUC Northern blotting (2.4 kb transcript) 10972810 (Yamamoto et al., Mol. Microbiol. 2000, 37(4):898-912) Northern blotting results in BSORF also show a monocistronic yflN transcript.
yflL yflL 836764..836827 -11.1 UCAGCGGCGAUGCCGAUCACGGACGCUACUUUUUUGAGCUUGUC Northern blotting; upstream and downstream genes are on the opposite strand BSORF
yflM,yflK yflMK 838077..838122 -19.8 AAAAAGCCGCGCAUAUCAACGUGCGCGGCUUUGCCAUAUUUAAG Northern blotting; downstream genes are on the opposite strand BSORF; SubtiList Note that the gene yflL is located between yflM and yflK, but on the opposite strand.
nagP nagP 841337..841389 -22.0 AAAAAGCGGAGAGGGCAACCUCUCCGCUUUUUCUUAUUUAUC Northern blotting 10627040 (Reizer et al., Microbiology 1999, 145(Pt.12):3419-3429); BSORF; Genbank D86417 bidirectional terminator
yflE yflE 841346..841406 -18.4 AAAAAGCGGAGAGGUUGCCCUCUCCGCUUUUUUAUUUGACAG Northern blotting; upstream and downstream gene are on the opposite strand BSORF; Genbank D86417 bidirectional terminator
yflA yflA 845490..845532 -7.1 AUACAUGGCUUUCGGGUCGAUUUUUGAGUGUAAAA Northern blotting; downstream genes are on the opposite strand BSORF
treP,treA,treR trePAR 853592..853645 -16.8 GAGAGGCGCCUGCCUGCGGCAGCGCGCUUUUUUGUUUGGUAU Northern blotting 8755887 (Schock et al., J. Bacteriol. 1996, 178(15):4576-4581); 8917076 (Schock & Dahl, Gene 1996, 175(1-2):59-63); BSORF Schock measured a trePA (3.2 kb) and a trePAR (more than 4 kb; weak) transcript. The short transcript was hybridized to a treA probe only; it was identified as a trePA transcript based on its length. Northern blotting results in BSORF show a trePAR, a treAR, and a treR transcript. Schock proposed the terminator CAGCGCGCTTTTTTGTTTGGTATCAAAATTGATACTATCCAACAAAAATGTGCGTACTTTTACTTTTTATCATAATGGCTACAATAGAGA (dG = -10.6 kcal/mole) at position 853628..853717; the indicated terminator was identified by mfold.
yfkO yfkO 854402..854454 -20.8 AAGAAAGCUGCUCGCAUAGCGAGCAGCUCUUUUUUAUGCCUGAU Northern blotting BSORF
yfkM yfkM 859590..859636 -17.8 AAAAACGGACGCUCUUGGGCGUCCGUUUUUUUGUUGCUUA Northern blotting; upstream and downstream genes are on the opposite strand 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); BSORF; SubtiList
yfkJ,yfkI,yfkH yfkJIH 863149..863199 -22.1 UAAAAGCCUCCUGACAUGAUGUCGGGAGGCUUUUUGAUUAAGAAG Northern blotting BSORF
yfkF yfkF 863157..863220 -17.8 AAAAAGCCUCCCGACAUCAUGUCAGGAGGCUUUUAUGCUAAUGGU Northern blotting BSORF; SubtiList
yfkE,yfkD yfkED 866451..866501 -13.6 AAAAACUGAUUCCAACUCGGAAUCAGUUUUUUUGUUUAUUG Northern blotting BSORF; Genbank D83967 bidirectional terminator
yfkA,yfkB,yfkC yfkABC 866460..866515 -13.5 AAAAACUGAUUCCGAGUUGGAAUCAGUUUUUUAUUUAUCUU Northern blotting BSORF; Genbank D83967 Northern blotting results in BSORF suggest that an internal promoter exists in front of yfkB. Bidirectional terminator.
yfjT yfjT 868776..868822 -8.3 UAAAACCGCGUGCCCGCCGCGGUUUUUUUAUUGGCAU Northern blotting BSORF; Genbank 83967
yfjS yfjS 869674..869728 -14.1 AAAGACCUCUCCUUAAACGGAGAGGCUUUUCUUUAUUUUAU Northern blotting (0.8 kb transcript) 12374835 (Fukushima et al., J. Bacteriol. 2002, 184(21):6007-6015); BSORF; Genbank D83967 bidirectional terminator
yfjR yfjR 869684..869728 -16.8 GAAAAGCCUCUCCGUUUAAGGAGAGGUCUUUCUCUUUUACAAA Northern blotting BSORF; Genbank D78509 bidirectional terminator
yfjQ yfjQ 870654..870703 -11.4 AAUGAGGACAGCGAGCAGCUGUUCUUUUUUGUUGUAAGC Northern blotting BSORF; SubtiList
yfjP,yfjO yfjPO 874163..874222 -21.8 AAUAAGACCUGGAUUUCGGUAAAAUAAACAAUUCCGAUUUCCGGGUCUUUUUCGUGCGCAGC Northern blotting BSORF
yfjN yfjN 876801..876841 -15.2 AAUAAACCUGGAUUUUCGGUAAAUCCGGGUCUUUUUUGUACGCAGC Northern blotting BSORF; SubtiList
yfjM,yfjL yfjML 878134..878171 -11.7 UCAAAGGCCGGGUGAUAUCCGGUCUUUUUUUUGCAUGCU Northern blotting BSORF; Genbank D78509
acoA,acoB,acoC,acoL acoABCL 882967..883024 -18.5 AAAAAGCAGGCGCAUGGAUAUAAGGCGCCUGCUUUUUUAUUGUUGAA Northern blotting; transcriptional fusions 11274109 (Ali et al., J. Bacteriol. 2001, 183(8):2497-2504) Transcriptional fusions showed that the downstream acoR does not belong to the acoABCL operon. However, Northern blotting results in BSORF show an acoABCLR-sspH transcript, an acoR-sspH transcript, and a monocistronic sspH transcript, but no acoABCL transcript.
acoR acoR ND ND ND 5' primer extension analysis of the downstream sspH gene; transcriptional fusions to acoR and the upstream acoABCL operon; Northern blotting 10333516 (Cabrera-Hernandez et al., Gene 1999, 232(1):1-10); 11274109 (Ali et al., J. Bacteriol. 2001, 183(8):2497-2504); BSORF Northern blotting results in BSORF show an acoABCLR-sspH transcript, an acoR-sspH transcript, and a monocistronic sspH trancript, but no acoABCL transcript.
sspH sspH 885129..885182 -14.9 AAAAAUGGCCCGCUUCAUAAGCAGGCCAUUUUGUUAUCCGCGC downstream gene is transcribed in the opposite direction 10333516 (Cabrera-Hernandez et al., Gene 1999, 232(1):1-10) Bidirectional terminator. Northern blotting results in BSORF show an acoABCLR-sspH transcript, an acoR-sspH transcript, and a monocistronic sspH trancript, but no acoABCL transcript.
yfjA,yfjB,yfjC,yfjD,yfjE,yfjF yfjABCDEF 885142..885189 -19.3 CAAAAUGGCCUGCUUAUGAAGCGGGCCAUUUUUGUUUAAUCCU Northern blotting BSORF; SubtiList Bidirectional terminator. Northern blotting results in BSORF suggest the existence of an internal promoter upstream of yfjC.
malA,yfiA,malP malA-yfiA-malP 893122..893166 -13.4 GACUGCCCUCCUUUUCGGGAGGGUUUUCGUUUGCCGUC Northern blotting (3.8 kb transcript) 11489864 (Yamamoto et al., J. Bacteriol. 2001, 183(17):5110-5121); Genbank D50543 Readthrough terminator exists downstream of malA, leading to a 1.4 kb transcript.
yfiB,yfiC yfiBC 896750..896799 -13.5 AAAUAGACCUUUGUCCUGCACAGAGGUCUUUUUUUGUUACAGU Northern blotting BSORF Northern blotting results in BSORF suggest the existence of an internal promoter downstream of yfiB.
yfiD,yfiE yfiDE 898195..898247 -24.0 UGCAAUCCCCUUGCCGAAAUAACGGCAGGGGGAUUUUUUAUUUUUGUC Northern blotting BSORF; Genbank D50543
yfiF yfiF ND ND ND Northern blotting BSORF
yfiG,yfiH,yfiI yfiGHI 903030..903072 -16.2 AUGCGCCGCAUAUGACAUAAAGUUCAUAUGCGGUUUUUAUUUUCCAGA Northern blotting BSORF; SubtiList Northern blotting results in BSORF suggest the existence of internal promoters upstream of yfiH and yfiI.
yfiJ,yfiK yfiJK 905022..905063 -8.9 GAAAAGGCCUUUUACAGGCCUUUUUUUCAUGCCCU Northern blotting 8973323 (Yamamoto et al., Gene 1996, 181(1-2):147-151); BSORF; Genbank D78508
padR padR 908458..908503 -15.2 AAAAACAUCUGCCUAAACGGCAGAUGUUUUUUAGGCUCGGA Northern blotting; upstream and downstream genes are on the opposite strand BSORF synonym: yfiO
lipB lipB 909968..910034 -11.2 AACAACCUGCUGUCUCCGUUACAGUGGGUUUUUUCGUCUGAGA Northern blotting BSORF; Genbank D78508
yfiQ yfiQ 911263..911300 -21.9 AACAAGCGGCAGGAGGGCUCCUGCCGCGUUUCUUUACUUCUCA Northern blotting BSORF; Genbank D85082 bidirectional terminator
yfiS,yfiR yfiSR 911264..911308 -20.0 GAAACGCGGCAGGAGCCCUCCUGCCGCUUGUUUUUCACCCUG Northern blotting BSORF; Genbank D85082 Bidirectional terminator. Northern blotting results in BSORF suggest the existence of an internal promoter upstream of yfiR.
yfiT yfiT 913890..913931 -7.7 UUCAGGAACGGGAAUGCGUUCGAUUUGUUCUUGUAAAG Northern blotting; upstream and downstream genes are on the opposite strand BSORF
yfiU yfiU ND ND ND Northern blotting; downstream gene is on the opposite strand BSORF
yfiV yfiV 915412..915454 -17.3 AGUAAGUCUGUCAUCCGCAAACUGCGGGAGCAGGCUUUUUUUAUUUGACA Northern blotting; upstream gene is on the opposite strand BSORF; SubtiList
yfiW,yfiX yfiWX 918660..918705 -19.0 AAAAAGACUCCGUCUAAUAAGACGGAGUCUUUUUUUAUUUCGUU Northern blotting BSORF; Genbank D85082 bidirectional terminator
yfiY yfiY 918664..918717 -18.4 AAAAAGACUCCGUCUUAUUAGACGGAGUCUUUUUUGCUUUUGCC Northern blotting; upstream and downstream genes are on the opposite strand BSORF; Genbank D85082 bidirectional terminator
yfiZ,yfhA yfiZ-yfhA 921830..921880 -15.9 UUACACCCAUUUUCUUAAAAAAGAAAAUGGGUUUUUUUGAUAAUGA Northern blotting 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); BSORF; Genbank D85082
yfhB yfhB ND ND ND ND ND Northern blotting results in BSORF show a yfhB, a yfhC, and a yfhBC transcript.
yfhC yfhC 923497..923544 -23.5 AAAAACCCCUUGUCUCAAACGGAGACAAGGGGUUUUUCAUUAACGAG downstream genes are on the opposite strand 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); SubtiList Bidirectional terminator. Northern blotting results in BSORF show a yfhB, a yfhC, and a yfhBC transcript.
yfhF,yfhE,yfhD yfhFED 923501..923557 -22.1 AAAAACCCCUUGUCUCCGUUUGAGACAAGGGGUUUUUUACAUUUCAG Northern blotting BSORF; Genbank D85082 Bidirectional terminator. Northern blotting results in BSORF show a yfhFED, a yfhED, and a monocistronic yfhE transcript.
yfhG,yfhH yfhGH 926080..926117 -14.8 AACAGGAGGCUGAUGAUCAGCCUCUUUUUGUUUGCAGCA Northern blotting BSORF; Genbank D85082 BSORF shows a yghGH and a monocistronic yfhH transcript, suggesting that an internal promoter exists upstream of yghH.
yfhI yfhI 927411..927449 -15.8 AAAAACAGCUGCAGUGUAUGCAGCUGUUCUUCUUUACCGUU Northern blotting BSORF; Genbank D85082
sspK sspK 927413..927457 -15.2 AAGAACAGCUGCAUACACUGCAGCUGUUUUUUACCCUUUAU upstream and downstream genes are transcribed in the opposite direction 10806362 (Cabrera-Hernandez, Gene 2000, 248(1-2):169-181)
yfhK,yfhL,yfhM yfhKLM 929913..929969 -11.6 CAUCCGUCUGUCAUAAUGGCAGACUUUUUCUGUGCGUUU Northern blotting (1.8 kb transcript) 10913081 (Antelmann et al, J. Bacteriol. 2000, 182(16):4478-4490) Internal promoters in front of yfhL and yfhM, leading to a 1.2 kb and a 0.9 kb transcript, respectively. SubtiList and Genbank D85082 list a terminator after yfhK, but none after yfhM. Northern blotting results in BSORF show a yfhK, a yfhLM, and a yfhKLM transcript. Huang (9987136) found a sigW-dependent promoter in front of yfhL; the promoter in front of yfhM has not yet been identified.
csbB csbB 931248..931285 -5.6 ACCAAGCGCCAUUGGCAGUGCUUUUUUUGCGUGUCU proposed 8921856 (Akbar & Price, Gene 1996, 177(1-2):123-128) Northern blotting results in BSORF show a csbB, a csbB-yfhO, and a yfhO transcript. Posisbly due to a sequencing error, Akbar & Price suggest a slightly different terminator.
yfhO yfhO 933772..933818 -15.6 AAAAAGCCCGGCUCUAUAUAGAGCCGAGCUUUAAUUUUUUCUGA proposed; downstream gene is on the opposite strand Genbank D85082 bidirectional terminator
yfhP yfhP 933775..933829 -20.2 UUAAAGCUCGGCUCUAUAUAGAGCCGGGCUUUUUACGUCUUAUA Northern blotting (1.1 kb transcript) 10463184 (Yamamoto et al., Microbiology 1999, 145(Pt.8):2171-2180); BSORF bidirectional terminator
yfhQ,fabL,sspE yfhQ-fabL-sspE 937484..937542 -14.5 AAAAAGCACUUCAUCUUCGGGUGGAAGUGCUUUUUUCUGUUUGAA Northern blotting (2.6 kb transcript) 3106326 (Hackett & Setlow, J. Bacteriol. 1987, 169(5):1985-1992); 10463184 (Yamamoto et al., Microbiology 1999, 145(Pt.8):2171-2180); BSORF The gene yfhS is located between yfhQ and fabL on the opposite DNA strand. Internal promoter in front of sspE, leading to a 0.3 kb transcript. Two internal promoters in front of fabL, leading to a 1.5 kb and a 1.3 kb transcript. A readthrough terminator TGGAAGATGGCAGGAGAAGCAGCCGCCATCTCGGCTGCTCCGTAAACCATTCTTAATCGTAAGAGACGC is located at 936056..936124 downstream of yfhQ, leading to a 1.2 kb transcript.
yfhS yfhS 936048..936092 -8.8 AGCAAUGAGCUGUUCACGCUCAGUUUUGAUCCCUUUUU Northern blotting (0.3 kb transcript) 10463184 (Yamamoto et al., Microbiology 1999, 145(Pt.8):2171-2180); BSORF
perR perR 944249..944299 -19.8 AAAAAUAAGCUGACCGCACGAAACGGUCAGCUUAUUUUAUUUCGACAUU downstream gene is on the opposite strand 12029044 (Fuangthong et al., J. Bacteriol. 2002, 184(12):3276-3286); SubtiList
rrnD-16S,rrnD-23S,rrnD-5S,trnD-Asn,trnD-Ser,trnD-Glu,trnD-Val,trnD-Met,trnD-Asp,trnD-Phe,trnD-Thr,trnD-Tyr,trnD-Trp,trnD-His,trnD-Gln,trnD-Gly,trnD-Cys,trnD-Leu1,trnD-Leu2 rrnD-16S-rrnD-23S-rrnD-5S-trnD-Asn-trnD-Ser-trnD-Glu-trnD-Val-trnD-Met-trnD-Asp-trnD-Phe-trnD-Thr-trnD-Tyr-trnD-Trp-trnD-His-trnD-Gln-trnD-Gly-trnD-Cys-trnD-Leu1-trnD-Leu2 952627..952675 -14.6 GAAAACCCGUUUCUUAACAGAAACGGGUUUUUAUUUUUUAUU Northern blotting; S1 nuclease mapping 6323435 (Wawrousek et al., J. Biol. Chem. 1984, 259(6):3694-3702); 3139657 (Vold et al., J. Biol. Chem. 1988, 263(28):14485-14490) The Northern blotting experiments showed the position of the terminators, but did not determine if all genes belong to the same operon. A second terminator sequence TTTATTTTTTATTAAAGAAAAGGAGCCTCGGCTCCTTTTTATACTTACTCAACGTATTGGTCT with dG = -16.2 kcal/mole is located at 952663..952725 immediately downstream of the indicated terminator (Vold et al., 3139657). Internal promoters in front of rrnD-5S and trnD-Leu2. A readthrough terminator downstream of trnD-Leu1 (proposed AACTAATCATATTAATGATCTACATAAGTAGATCATTTTTTTAATGCTTTGATTTATCA at 952330..952388 with dG = -13.9 kcal/mole) prevents most transcripts to continue into trnD-Leu2, which is therefore mainly transcribed from its own promoter.
spo0M spo0M 952676..952716 -8.4 AAAAAGGAGCCGAGGCUCCUUUUCUUUAAUAAAA upstream and downstream genes are transcribed in the opposite direction 9795118 (Han et al., Gene 1998, 217(1-2):31-40)
senS senS 958816..958876 -7.2 AAAAACCCGCUGACUACAACGGGUUUUUGCAUUUCUCC upstream and downstream gene are on the opposite strand Genbank M34826 bidirectional terminator
katA katA 958825..958874 -10.6 AAAAACCCGUUGUAGUCAGCGGGUUUUUUUAUAUUUAG upstream and downstream genes are on the opposite strand SubtiList bidirectional terminator
yhbF yhbF 972146..972202 -18.5 AAAAAGGGUGCUCUUUCAGGAGCACCCUUUUUUAUUCUUUUC proposed 8626065 (Fischer et al., Gene 1996, 168(1):55-60)
prkA prkA 974377..974425 -19.2 AACGUGACCCGUCCGAAUAGGGCGGGUUAUUUUGUCCCAUUUUC proposed 8626065 (Fischer et al., Gene 1996, 168(1):55-60)
yhbH yhbH 975725..975778 -7.8 GAAAAGCCCAUUUCAGGGCUUUUUUUUAUUUAAU proposed 9579061 (Noback et al., Microbiology 1998, 144(Pt.4):859-875); Genbank Y14082
yhcH yhcH ND ND ND ND ND
cspB cspB 983550..983596 -17.5 AAAAACUGCAGGUGCAAACCUGCAGUUUUUAUUUUGACAA proposed 1400185 (Willimsky et al., J. Bacteriol. 174(20): 6326-6335, 1992) An alternative putative terminator is AAAAAGCUGUUUUGCAUAAGCAAAACAGCUUUUUUUAUUAGUUU (dG = -16.9 kcal/mole) located at 983503..983546.
yhcN yhcN 988911..988964 -16.1 AAGAAGCCGCACAAUUUGUGCGGCUUUUUCUUUGCGUUA proposed 9611260 (Bagyan et al., Gene 1998, 212(2):179-188); Genbank X96983
yhxA,glpP yhxA-glpP 1001713..1001815 -30.9 CGGAGACCACAGCAGCTCTTTACGGCAAATGTTTATGCACCCGTAAAGCGGTTTGTTGTGGTTTTTTTATTCTCTTCTTCTCTATCATGCTTTTTAATCGTGA Northern blotting (1.8-2.1 kb transcript) 2127799 (Holmberg et al., J. Gen. Microbiol. 136:2367-2375, 1990); 8436953 (Beijer et al., J. Gen. Microbiol. 139(Pt.2):349-359, 1993); 1479885 (Holmberg & Rutberg, Mol. Microbiol. 1992, 6(20):2931-2938) This terminator also functions as a terminator/anti-terminator for transcription of glpFK. Readthrough may occur. mfold calculations shows that TGT and GCA in the loop might form base-pairs, leading to dG = -32.3 kcal/mole.
glpF,glpK glpFK 1004212..1004268 -37.5 GAGGAGAGACCACAGCACCAAAGUGUAAGCAUGCACUUUGGCUGUUGUGGUCUCUUUUUCUAUUUACCG Northern blotting (2.4 kb transcript); S1 nuclease mapping of the 3' end 2127799 (Holmberg et al., J. Gen. Microbiol. 136:2367-2375, 1990); 8436953 (Beijer et al., J. Gen. Microbiol. 139(Pt.2):349-359, 1993); 1809833 (Holmberg & Rutberg, Mol. Microbiol. 5(12):2891-2900, 1991); 1479885 (Holmberg & Rutberg, Mol. Microbiol. 1992, 6(20):2931-2938) Readthrough at this terminator leads to a 4.4 kb glpFKD transcript. This terminator also functions as a terminator/anti-terminator for transcription starting from the glpD promoter. S1 nuclease mapping of the 3' mRNA end shows that transcription ends in the TGGTCTCT section just in front of the T-stretch.
glpD glpD 1005968..1006012 -13.5 CAUAACGGGCUGUCUGCAGCCCGUUAUUUCUUUUUACG Northern blotting (1.8 kb transcript); S1 nuclease mapping of the 3' end 2127799 (Holmberg et al., J. Gen. Microbiol. 136:2367-2375, 1990); 8436953 (Beijer et al., J. Gen. Microbiol. 139(Pt.2):349-359, 1993); 1809833 (Holmberg & Rutberg, Mol. Microbiol. 5(12):2891-2900, 1991); 1479885 (Holmberg & Rutberg, Mol. Microbiol. 1992, 6(20):2931-2938) The Northern blotting experiment showed a 4.4 kb glpFKD transcript due to readthrough of the glpFK terminator. A primer extension analysis revealed the existence of a promoter in front of glpD, which is the major promoter for glpD transcription. The S1 nuclease mapping results show that transcription ends in the section CCGTTATTTC.
lytF lytF 1011034..1011085 -18.5 AGAAACUGUGCGGCCUUAACGGCUGUACAGUUUUUAUUAGAGCCU Northern blotting (1.5 kb transcript) 10322020 (Ohnishi et al., J. Bacteriol. 1999, 181(10):3178-3184); 10206711 (Margot et al., Microbiology 1999, 145(Pt.1):57-65)
yhdE yhdE 1012672..1012728 -11.2 AAAAUGAAGGAAUAGAUUAAGAUUCCUUCUUUUUUUAUGCCCUU proposed 10322020 (Ohnishi et al., J. Bacteriol. 1999, 181(10):3178-3184); 10206711 (Margot et al., Microbiology 1999, 145(Pt.1):57-65); Genbank Y14079
spoVR spoVR 1016326..1016368 -13.3 AAAGAGGAUGCAGCGUUCUGCAUCCUUUUUAUUUUCCAGU proposed; upstream and downstream gene are on the opposite strand 8144469 (Beall & Moran, J. Bacteriol. 1994, 176(7):2003-2012) bidirectional terminator
phoA phoA 1016332..1016380 -16.8 UAAAAAGGAUGCAGAACGCUGCAUCCUCUUUUUUAUAAAUAUC proposed; upstream and downstream gene are on the opposite strand 8144469 (Beall & Moran, J. Bacteriol. 1994, 176(7):2003-2012) bidirectional terminator
lytE lytE 1019309..1019353 -13.3 GAAAACCCGUUCAUUGGAACGGGUUUUUUUCAUUAGAC transcriptional fusion; Northern blotting (1.1 kb transcript) 9573210 (Ishikawa et al., J. Bacteriol. 1998, 180(9):2549-2555); Genbank Y14082 bidirectional terminator
citR citR 1019317..1019367 -11.9 AAAAACCCGUUCCAAUGAACGGGUUUUCUCUAAAAAUU proposed 8045898 (Jin & Sonenshein, J. Bacteriol. 176(15), 4669-4679, 1994) bidirectional terminator
citA citA ND ND ND proposed 8045898 (Jin & Sonenshein, J. Bacteriol. 176(15), 4669-4679, 1994)
yhdF yhdF 1022397..1022443 -9.3 AAAAACCAGCUCAAGAGCUGGUUUUUUGUGUGGUGA ND ND
yhdG yhdG 1024050..1024100 -18.3 AUAAAGAGAGCGGCCAUACAGGCCGCCUCUUUUCUGUUCUUGGC Northern blotting (1.5 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); Genbank Y14082
yhdJ yhdJ 1027506..1027543 -15.9 AAAAAGACGCCUGAAAAGGCGUCUUUUUUAAAAGCCAA proposed Genbank Y14082 bidirectional terminator
sigM,yhdL,yhdK sigM-yhdLK 1027510..1027553 -12.6 AAAAAGACGCCUUUUCAGGCGUCUUUUUUCGUUAUACC Northern blotting (1.9 kb transcript) 10216858 (Horsburgh & Moir, Mol. Microbiol. 1999, 32(1):41-50); Genbank Y14082 same as yhdJ
yhdN,yhdO yhdNO 1031320..1031374 -8.1 GAAAAGCACCCUAUACAAGGUGCUUUUCUUAUUAUGCU Northern blotting (1.8 kb transcript) 10220166 (Petersohn et al., Microbiology 1999, 145(Pt.4):869-880); Genbank Y14082 Termination at a readthrough terminator AAATATAACAAAAGCTGAGGGCGAATCCTCAGCTTTTTGGCGTTTAAACGAGAG with dG = -18.5 kcal/mole at position 1030561..1030614 between yhdN and yhdO leads to a 1.2 kb transcript.
nhaX nhaX 1043652..1043702 -15.8 GUAAAGUGAGCACGCCCUGUGCUCACUUCUUUUAUAUUCAU ND ND synonym: yheK
sspB sspB 1049289..1049332 -20.2 CUAUAGAGGGCGCGGUUUCCGCGCUCUCUUUAUUUUGUCACCC Northern blotting (0.35 kb transcript) 3009398 (Connors et al., J. Bacteriol. 1986, 166(2):417-425)
yhaX yhaX 1056863..1056919 -22.5 AAAAAGCCGCUCGCGCCCUGACAGGUGCGGCGGCUUUUUUGCCGGAUUG proposed 10498703 (Homuth et al., J. Bacteriol. 1999, 181(19):5922-5929)
hemZ hemZ 1058470..1058515 -17.1 ACAAAGCAGCACUGAUUACAGUGCUGCUUUUUUUAUCCCUGU Northern blotting (1.6 kb transcript) 10498703 (Homuth et al., J. Bacteriol. 1999, 181(19):5922-5929)
hpr hpr ND ND ND downstream gene is on the opposite strand 3131303 (Perego & Hoch, J. Bacteriol. 1988, 170(6):2560-2567)
yhaG yhaG 1073909..1073959 -14.6 CAAAACCUCUUCCGCUUCCGGGAGAGGUUUUUUUGAACAGAG proposed 10735881 (Sarsero et al., J. Bacteriol. 2000, 182(8):2329-2331)
yhgC yhgC 1082504..1082538 -17.1 GAAUAGCUGCCGGCAUGUCCGGCAGCUUAUUUUAUUGGGAG proposed 8335642 (Popham & Setlow, J. Bacteriol. 1993, 175(15):4870-4876)
pbpF pbpF ND -6.3 CAAAAUUGUUUUCCUCUUAAUGGAAUUCGGCGAUUUUUUGAACUUUGA Northern blotting of downstream hemEHY operon 1459957 (Hansson & Hederstedt, J. Bacteriol. 1992, 174(24):8081-8093)
hemE,hemH,hemY hemEHY 1088885..1088946 -15.0 UAAAACCUCCGCUUUAUCGCGGAGGUUUUUUUGAUGUGCA Northern blotting (3.7 kb transcript) 1459957 (Hansson & Hederstedt, J. Bacteriol. 1992, 174(24):8081-8093)
yhfN yhfN 1103682..1103733 -15.8 AAAAAGAAGCAGGUAUGGAGGAACCUGCUUCUUUUUACUAUUAUUG upstream and downstream genes are on the opposite strand Genbank Y14083 bidirectional terminator
aprE aprE 1103683..1103740 -15.2 AAAAAGAAGCAGGUUCCUCCAUACCUGCUUCUUUUUAUUUGUCAGC upstream and downstream genes are on the opposite strand Genbank Y14083 bidirectional terminator
yhfQ yhfQ 1107991..1108045 -14.1 GAAAAGACAGGCAAACGCCUGUCUUUUUCUUAUUUGAU downstream genes are on the opposite strand 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); Genbank Y14084
hemAT hemAT 1111882..1111937 -10.1 AAAAACCGGUCUGCCAUACGGCCGGUUUUUUUGCGUUCAU Northern blotting (1.3 kb transcript) 15033535 (Serizawa et al., Gene 2004, 329:125-136); Genbank Y14084
yhfW yhfW 1113325..1113376 -9.6 UAAACCGUUCAUUUUAAUGAACGUUUUUUCAAAUAUUU proposed 15033535 (Serizawa et al., Gene 2004, 329:125-136); Genbank Y14084
yhxC yhxC 1115861..1115895 -15.7 AAAAAGCCAAUCCUUGAAGGAUUGGCUUAUUCGCUCUGCUU proposed 8196543 (Van Sinderen et al., Mol. Microbiol. 11(4): 695-703, 1994) bidirectional terminator
yhzC yhzC 1115858..1115898 -15.7 AAUAAGCCAAUCCUUCAAGGAUUGGCUUUUUAUUAUCCGUU proposed 8196543 (Van Sinderen et al., Mol. Microbiol. 11(4): 695-703, 1994) bidirectional terminator
comK comK 1116987..1117033 -16.7 AUUAGAAAAAUAGGAAGGAGCUGACCGAACAGGGCAGCUCCUUUCAUAAAGCUAUG proposed; upstream and downstream gene are on the opposite strand 8196543 (Van Sinderen et al., Mol. Microbiol. 11(4): 695-703, 1994) bidirectional terminator
yhxD yhxD 1116990..1117041 -16.1 UGAAAGGAGCUGCCCUGUUCGGUCAGCUCCUUCCUAUUUUUCUAA proposed; upstream and downstream gene are on the opposite strand 8196543 (Van Sinderen et al., Mol. Microbiol. 11(4): 695-703, 1994) bidirectional terminator
yhjB yhjB 1118422..1118470 -14.5 AAAAAGCAAUCUGGACACCAGAUUGCUUUUUCUUAUUUACC downstream gene is on the opposite strand Genbank Y14081
addB,addA addBA 1142818..1142858 -25.4 UAGCGAGAUCCAUAAGCUCCGGAAUUUCAGGCGGAGCGGGUCUCGUUUUCU proposed 1646786 (Kooistra & Venema, J. Bacteriol. 173(12) 3644-3655, 1991) Terminator contains a stretch of four subsequent mismatches.
sbcD sbcD ND ND ND ND ND
asnO asnO 1158417..1158480 -19.9 AAGAAGGAUAGAUGAGCAGGGAAAUAUAUGCUCUAUCUAUCCUUUUUUGUACAACAG Northern blotting (2.0 kb transcript) 10498721 (Yoshida et al., J. Bacteriol. 1999, 181(19):6081-6091); Genbank Z93940
argC,argJ,argB,argD,carA,carB,argF argCJBD-carAB-argF 1203705..1203751 -14.3 AAAAACUGCUGAGCCAAACUCAGCAGUUUUUUUGAUGGCAA proposed 8025667 (O'Reilly & Devine, Microbiology 140(5), 1023-1025, 1994); 7511775 (O'Reilly et al., Mol. Microbiol. 1994, 11(1):87-98); 9335269 (Ogura et al., J. Bacteriol. 1997, 179(20):6244-6253)
yjzC yjzC 1203994..1204039 -13.9 AAAAACCCAAAACAAUAAAUGUUUUGGGUUUUUGGCUUUUUAA proposed 9335269 (Ogura et al., J. Bacteriol. 1997, 179(20):6244-6253)
med,comZ med-comZ 1207084..1207136 -11.7 AAGAAGCCACUUUUUUGAAAGUGGCUUUUCACAUGAUUUU Northern blotting (1.25 kb transcript) 9335269 (Ogura et al., J. Bacteriol. 1997, 179(20):6244-6253) a transcript starting upstream of yjaU may end at the same terminator
appD,appF,appA,appB,appC appDFABC 1216463..1216523 -14.9 AAAAAGCAGGUCUCCUUUAGUCAGAAAAUAUACAAAGAGAUCUGCUUUUUAUGAUUCUUA proposed 7997159 (Koide & Hoch, Mol. Microbiol. 1994, 13(3):417-426)
oppA,oppB,oppC,oppD,oppF oppABCDF 1224762..1224804 -20.9 AUCAAUCCUUCAAGAGAUUUCUCUUGAAGGAUUUUUUUGCGUCUUC Northern blotting (6.0 kb transcript) 1901616 (Perego et al., Mol. Microbiol. 1991, 5(1):173-185); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165) The secondary structure of the RNA corresponding to the oppA-oppB intergenic region may enhance the stability of the mRNA molecule (Perego), or function as a readthrough terminator (1.8 kb oppA transcript found by Yoshida).
yjbC,yjbD yjbCD 1227409..1227454 -16.8 CAAAAGAAGGCUGAGUCAUCAGCCUUCUUUUAUUUUUCAACC Northern blotting (1.2 kb transcript) 10913081 (Antelmann et al, J. Bacteriol. 2000, 182(16):4478-4490); SubtiList
mecA mecA 1229030..1229071 -15.1 GCAAACCGAUUUCCUUCCGGAAAUCGGUUUUUUUUAUGCACG proposed 8412687 (Kong et al., Mol. Microbiol. 1993, 9(2):365-373)
yjbF yjbF 1230394..1230430 -7.6 GCUGUGAAAGGCACAAAAGGAAAGGUUUUUCGUGUUUUUACUGCUUUUU ND ND
yjbJ yjbJ 1234446..1234488 -11.8 CGUAACCAGAGGUGCUCUUUCCCUCUGGUUUUUUUGCGAAGUG proposed 15033535 (Serizawa et al., Gene 2004, 329:125-136)
tenA,tenI tenAI ND ND ND lacZ transcriptional fusions 1898926 (Pang et al., J. Bacteriol. 1991, 173(1):46-54) The lacZ transcriptional fusions showed that tenA and tenI belong to the same operon. Genes further downstream may also belong to this operon.
yjbX yjbX 1248657..1248708 -16.6 AAAAAGCUGCCCGGCUGAUGUUGCCGGACAGCUUUUUUUACAUAGAG downstream gene is in the opposite direction ND
cotY,cotZ cotYZ ND -11.6 GAAAAGCUUGCAGGCCUGCAGGCUUUUCUCUAUGUAAA Northern blotting (1.4 kb transcript) 7519271 (Zhang et al., J. Mol. Biol. 1994, 240(5):405-415); 8509331 (Zhang et al., J. Bacteriol. 1993, 175(12):3757-3766) Zhang et al. proposed the terminator CUUUUCUCUAUGUAAAAAAAGCUGUCCGGCAACAUCAGCCGGGCAGCUUUUUUCUUUUUCGU (dG = -21.6 kcal/mole) at position 1248664..1248721 slightly further downstream. A readthrough terminator or an mRNA processing site ATTACAGGTGCAAATCATTCAGCTGCTTCCAGCGTGAGGCAGCTGACTCTCCATCATTT was found downstream of cotY at 1249236..1249294, leading to a 0.6 kb transcript.
cotV,cotW,cotX cotVWX 1249925..1249966 -13.5 UAAAAGCAGAGCUAAAAACGCUCUGCUUUUUCUUAUUUUCC Northern blotting (1.6 kb transcript) 7519271 (Zhang et al., J. Mol. Biol. 1994, 240(5):405-415); 8509331 (Zhang et al., J. Bacteriol. 1993, 175(12):3757-3766) internal promoter in front of cotX, leading to a 0.6 kb transcript.
yjcI,yjcJ yjcIJ 1260082..1260126 -17.1 AAAAAGAAGCCGGGGAUAGUCCGGCUUCUUUUAUUAUUGUUCG Northern blotting (2.5 kb transcript) 11832514 (Auger et al., Microbiology 2002, 148(Pt.2):507-518)
yjcP,yjcQ yjcPQ 1266705..1266756 -9.1 UAAGAGCAUCCUGCGGGGUGCUUUUUUUGUUCCCUG Northern blotting (0.8 kb transcript) 15033535 (Serizawa et al., Gene 2004, 329:125-136)
cotT cotT 1279888..1279930 -12.8 CAAAAUGGGGGCAGUCCAGCUCCCCAUUUUUUUGUUUUAAA proposed 2546006 (Aronson et al., Mol. Microbiol. 1989, 3(3):437-444)
yjfB yjfB 1282428..1282490 -16.8 CCAGAGGCGGCCAAGAACUCCAUCCUCCCGGCCGCCUUUAUUGUUCACAAA Northern blotting (0.2 kb transcript) 15033535 (Serizawa et al., Gene 2004, 329:125-136); 9579062 (Rivolta et al., Microbiology 1998, 144(Pt.4):877-884) A 0.8 kb readthrough transcript was also detected.
yjgB yjgB 1284146..1284193 -11.6 CCUACGCGGCUAUUCAGCCGCUUUUUUAGUGGACAA ND ND
uxaC,yjmB,yjmC,yjmD,uxuA,yjmF,exuT,exuR,uxaB,uxaA uxaC-yjmBCD-uxuA-yjmF-exuTR-uxaBA 1312111..1312162 -14.6 GAAAAGGCUAUCCUUCAAGCGGAUAGCCUUCUUCAUUAAAUCA proposed 9882655 (Mekjian et al., J. Bacteriol. 1999, 181(2):426-433); 9579062 (Rivolta et al., Microbiology 1998, 144(Pt.4):877-884) internal promoter in front of yjmC
yjoB yjoB 1315024..1315074 -16.7 AGAAAGCACGGGUGUUUGAAAAACCCGUGCUUUUUUGUUGCGGUU primer extension of downstream rapA gene 1378051 (Mueller et al., J. Bacteriol. 1992, 174(13):4361-4373)
rapA,phrA rapA-phrA 1316437..1316474 -8.9 AAAAAGACCCUUAGGGGUCUUUUUUAUUUCUUCA hybrid formation with RNA probes; nuclease protection experiments 1378051 (Mueller et al., J. Bacteriol. 1992, 174(13):4361-4373); Genbank AF034138
xre xre ND ND ND proposed 8083174 (McDonnell et al., J. Bacteriol. 1994, 176(18):5820-5830)
xkdB,xkdC,xkdD,xtrA xkdBCD-xtrA 1323690..1323741 -34.7 GCCUGCGGACACUGAUCAACUGCACAGCAUUUGUGCGUUGAUUGGUGUCCGUUUUUUAUUUGCCAA proposed 8083174 (McDonnell et al., J. Bacteriol. 1994, 176(18):5820-5830)
xtmA,xtmB,xkdE,xkdF,xkdG,xkdH,xkdI,xkdJ,xkdK,xkdM xtmAB-xkdEFGHIJKM 1333564..1333609 -15.6 AUACGCAGACCUUUCUCAGAAAGGUCUGUUUUUUAAAGAUGAA proposed 2110147 (Wood et al., J. Bacteriol. 1990, 172(5):2667-2674) Wood et al. assume an operon of at least 19 kb, presumably including the downstream genes xkdNOPQRSTUVWX-xepA-xhlAB-xlyA
htrA htrA 1357199..1357236 -24.4 AUAAUGCCUCAGGCCGUAAAAGCGGUCUGAGGCUUUUUAUUAGAUAAA upstream and downstream genes are on the opposite strand ND
proG proG 1359570..1359606 -13.6 AACAUGAAUCCUUGAAAGAGGAUUCUUUUUUUAUCACUGA proposed 1766370 (Mathiopoulos et al., Mol. Microbiol. 5(8):1903-1913, 1991) synonym: ykeA
dppA,dppB,dppC,dppD,dppE dppABCDE 1365105..1365163 -17.3 GGAAAUACUGCUUCUUUAUGCGAAGGAGCGGUAUUUUUCCUCUUUCUU Northern blotting (5.9 kb transcript) 1766370 (Mathiopoulos et al., Mol. Microbiol. 5(8):1903-1913, 1991); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
ykgA,ykgB ykgAB 1369136..1369191 -20.0 AAAUGGAGUGGCUCUAGUAAAAAGGAGCCACUCUUUUUAUUUAUCUUA proposed 10482513 (Petersohn et al., J. Bacteriol. 1999, 181(18):5718-5724)
hmp hmp 1373292..1373341 -12.3 UGAAACUCUUCUCCUUUCAGAGAAGAGUUUUUUAUUGAGAUA downstream gene is on the opposite strand 8682784 (LaCelle et al., J. Bacteriol. 1996, 178(13):3803-3808); SubtiList
yklA yklA 1380699..1380750 -22.8 AAAAAGAGGAUGCCUGUACAAGGCAUCCUCAAUUUUUUUGAUGAAGU proposed 9696771 (Volker et al., J. Bacteriol. 1998, 180(16):4212-4218) bidirectional terminator
ykmA ykmA 1380708..1380762 -19.3 AAAUUGAGGAUGCCUUGUACAGGCAUCCUCUUUUUAUUUAUUCAG proposed 9696771 (Volker et al., J. Bacteriol. 1998, 180(16):4212-4218) bidirectional terminator
ykzA ykzA 1381740..1381774 -15.1 ACCGGCAUCCUGAGGAUUCUCAGGAUGUUUUUUGGUGUCGGA Northern blotting (0.5 kb transcript) 9696771 (Volker et al., J. Bacteriol. 1998, 180(16):4212-4218) readthrough at this terminator leads to 0.8 kb and 1.4 kb transcripts
guaD guaD 1381947..1381989 -17.7 UAAAAGGAUCAGGCAUGCGCGGCCUGGUCCUUGUUAUUUCUCCAA downstream gene is on the opposite strand 11101664 (Nygaard et al., Microbiology 2000, 146(Pt.12):3061-3069)
tnrA tnrA 1396676..1396722 -12.4 UAAAAGUCCGGCUCGCAGUUGAGACGGACUUUUUACGUUUAUAA upstream and downstream genes are on the opposite strand Genbank U55004
ykzB,ykoL ykzB-ykoL 1397633..1397693 -14.1 AAUUAUCCUUAUACAAGAUAAUGUAUAAGGAUUUUUUUGCUUUUAG primer extension experiments for both genes 10671441 (Robichon et al., J. Bacteriol. 2000, 182(5):1226-1231) internal promoter in front of ykoL
sigI sigI ND ND ND ND ND
sspD sspD 1413051..1413103 -18.3 UCUUUAUUCGCCGGGGGCACUCGGCGAAUCUUCAUUUUUAGCUGA downstream gene is transcribed in the opposite direction 3009398 (Connors et al., J. Bacteriol. 1986, 166(2):417-425)
spo0E spo0E 1430260..1430305 -9.5 AUAAAGAGAGAGCUUUUCGGAAGCGCUCUUUUUUUCUGGAAAA proposed 2838724 (Perego & Hoch, Mol. Microbiol. 1987, 1(1):125-132)
eag eag ND ND ND proposed 2838724 (Perego & Hoch, Mol. Microbiol. 1987, 1(1):125-132) The terminator GAUAAAAAACCCUCCUGACAUGGUCAGGGGGGCUAUGAUGC (dG = -20.0 kcal/mole) proposed by Perego at position 1430762..1430802 lacks a T-stretch.
motA,motB motAB 1432943..1433003 -15.6 AAAAAGGAAGCCUUGUGACAUAUCAGGCUUCCUUUUUUUACUUAUUA Northern blotting (1.6 kb transcript) 6313226 (Gilman & Chamberlin, Cell 1983, 35(1):285-293); 1624413 (Mirel et al., J. Bacteriol. 1992, 174(13):4197-4204)
clpE clpE 1434888..1434949 -17.7 AAUCAGCGGUUUCCUUUUAGGAAGCCGCUUUUUUUUAUACUUU proposed 10320580 (Derre et al., Mol. Microbiol. 1999, 32(3):581-593)
ykvI ykvI 1438620..1438663 -14.7 GACGAGCUGUAUCCUUGGAUACGGCCUUUUUUAUGUUUUUC proposed 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)
ykvP,ykvQ ykvPQ ND ND ND Northern blotting (2.5 kb transcript) 11011148 (Kodama et al., J. Biochem. (Tokyo) 2000, 128(4):655-663)
ykvU,ykvV ykvUV 1450421..1450473 -14.3 GAAUAGCUGAGAGCAUAGACUCUCAGCUUUUUUCAUAUAGAG Northern blotting (2.0 kb transcript) 15292147 (Imamura et al., J. Bacteriol. 2004, 186(16):5450-5459)
ykvW ykvW 1452574..1452628 -21.6 UAAAACCAGCAGCCUAAUCAGGCUGCUGGCUUUUUAUGUAUCAAG proposed 12180919 (Gaballa & Helmann, Mol. Microbiol. 2002, 45(4):997-1005)
ptsG,ptsH,ptsI ptsGHI 1460669..1460711 -17.9 AAAAACCAGACGGCCUCCGGCCUGUCUGGUUUUUUUCAUAAGUA Northern blotting (4.6 kb transcript) 7686067 (Reizer et al., Protein Sci. 1993, 2(4):506-521); 2497294 (Gonzy-Treboul et al., Mol. Microbiol. 1989, 3(1):103-112); 11902727 (Stulke et al., Mol. Microbiol. 1997, 25(1):65-78); 11489127 (Ludwig et al., Mol. Microbiol. 2001, 41(2):409-422) Internal promoter in front of ptsH, leading to a 2.0 kb transcript.
splA,splB splAB 1462094..1462141 -16.9 UUAAACGGGCUGUUGUGAUCAACAGCUCGCUUUUUUAUAAAAAAC 5' primer extension of splB 10629212 (Fajardo-Cavazos & Nicholson, J. Bacteriol. 2000, 182(2):555-560); 8021181 (Pedraza-Reyes et al., J. Bacteriol. 1994, 176(13):3983-3991)
mcpC mcpC 1464898..1464946 -18.4 UUACAUCCCCAAACAUCAUUUGUUUGGGGAUUUUUUAUUUUAUAA proposed 9353924 (Muller et al., Microbiology 1997, 143(Pt.10):3231-3240)
kinA kinA 1471136..1471181 -12.8 AAUAAAAACAACGGCUUAAACGCCGUUGUUUAUCGUCUGCAUU linearized/supercoiled templates; downstream gene is transcribed in the opposite direction 1569009 (Predich et al., J. Bacteriol. 1992, 174(9):2771-2778); 2509430 (Perego et al., J. Bacteriol. 1989, 171(11):6187-6196)
cheV cheV 1473807..1473861 -18.8 AAAAACAGCCGUUGCCAGAAAGAGGCACGGCUGUUUUUAUUUUAAAAG proposed 8169223 (Fredrick & Helmann, J. Bacteriol. 1994, 176(9):2727-2735) bidirectional terminator
ykyB ykyB 1473816..1473872 -18.5 AAAAACAGCCGUGCCUCUUUCUGGCAACGGCUGUUUUUAUUUAUUCAA proposed 8169223 (Fredrick & Helmann, J. Bacteriol. 1994, 176(9):2727-2735) bidirectional terminator
ykuD ykuD 1475806..1475850 -2.5 UCACGAUUAACCGGUAAUGUUUUCUUAUUUGUUU Northern blotting (0.9 kb transcript) 11011148 (Kodama et al., J. Biochem. (Tokyo) 2000, 128(4):655-663)
ccpC ccpC 1486219..1486257 -11.2 UUAAAGACAGCGAGGUGCUGUCUUUUUUUUAUUUAUC proposed 11985717 (Kim et al., Mol. Microbiol. 2002, 43(2):399-410)
ykuN,ykuO,ykuP ykuNOP ND ND ND proposed 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629)
rok rok 1493656..1493714 -13.0 AAAAACUGCUUGGCAUCGCUCAAGCAGUUUUUUUAUUGAGGU proposed 11849533 (Hoa et al., Mol. Microbiol. 2002, 43(1):15-26)
yknT yknT 1493674..1493724 -13.0 AAAAACUGCUUGAGCGAUGCCAAGCAGUUUUUCUUUAUAUUU upstream and downstream genes are in the opposite direction 8990290 (Henriques et al., J. Bacteriol. 1997, 179(2):389-398)
yknW,yknX,yknY,yknZ yknWXYZ 1506594..1506638 -15.5 AGUAGCCUCAUGCAACAUGCAUGAGGUUUUUUUAUGUUUAG proposed 9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371); Genbank AF012285
fruR,fruK,fruA fruRKA 1510455..1510511 -14.8 AAAAAGCGUCCUUGGUUCGAAAGGACGCUUUUUCUUAUCCGGC proposed Genbank AF012285
sipT sipT 1511177..1511236 -15.7 AAAAACGCCUUGCUGGCCUAGGACAGCAGGCGUUUUUAUUUUGAAAA Northern blotting 9694797 (Tjalsma et al., Genes Dev. 1998, 12(15):2318-2331); Genbank AF012285
abh abh 1517439..1517498 -15.2 AAAAAGGCGGAGUGAUAUCAUCUCCGCCUUUUUUGCGUGCCAA proposed 8002614 (LeDeaux and Grossman, J. Bacteriol. 1995, 177:166-175)
kinC kinC ND ND ND ND ND
pdhA,pdhB,pdhC,pdhD pdhABCD 1532585..1532640 -18.5 AAAAACAGCCCCGCUUUGAGCGAGGGCUGUUUUUUUAUUUUGAC Northern blotting (5.2 kb transcript) 1697575 (Hemila et al., J. Bacteriol. 1990, 172(9):5052-5063); 11976308 (Gao et al., J. Bacteriol. 2002, 184(10):2780-2788) Hemila also found a 2.8 kb pdhCD and a 1.7 kb monocistronic transcript. However, Gao et al. note that promoters were found in front of pdhA and pdhC only; no promoter was found in front of pdhD.
nprE nprE 1539284..1539345 -12.9 GAAAAGCCUGAGAUCCCUCAGGCUUUUAUUGUUACAUA proposed Genbank AF012285
ctaA ctaA 1557287..1557342 -19.2 CAUAAGGACUCAAGACCAAAGCCUUAGGCGGCUUUGGUCUUUUUUAUGUCUUGU RNase protection hybridization 2549007 (Mueller & Taber, J. Bacteriol. 171(9): 4979-4986, 1989) The RNase protection hybridization shows that transcription ends in the TTTGGTCTTTTTT stretch.
ctaB ctaB 1559595..1559632 -5.0 CCUUGACCUCUUGUUUAAUCAGGCGGCUUUACUUUUAU RNAse protection mapping of the 3' terminus of the transcript 9829923 (Liu & Taber, J. Bacteriol. 1998, 180(23):6154-6163) The RNAse protection mapping of the 3' end showed that transcription ends at the end of the stem-loop. A longer ctaBCDEF transcript was also detected; its origin is unknown.
ylbJ ylbJ 1569849..1569891 -10.2 UGACAAACGGAACAAAAAAAGGAUGAGUCAAAACCCUCAUCCUUGUCUGAAUUUUUG upstream and downstream genes are in the opposite direction Genbank Z98682
yllA yllA 1579299..1579344 -10.4 AAGAACCCUGACUAGUUCAGGGUUUCUUUUUAUGGGU proposed 8636036 (Daniel et al., J. Bacteriol. 178(8):2343-2350, 1996)
yllB,ylxA,ftsL,pbpB yllB-ylxA-ftsL-pbpB 1583410..1583436 -12.2 UGAUUAAAAAGAAAGCCGUCGUUAUGCAGGCUUUCUUUUUUUAUGCCUUC proposed 8636036 (Daniel et al., J. Bacteriol. 1996, 178(8):2343-2350); 8244929 (Yanouri et al., J. Bacteriol. 1993, 175(23): 7604-7606)
spoVD spoVD 1585439..1585478 -19.3 AAAGGAGGCAGCCGAUUGAUUCGGGCUGCCUAUUCUUUUAUUGCAGA proposed 8436954 (Daniel & Errington, J. Gen. Microbiol. 139:361-370, 1993)
murE,mraY,murD,spoVE,murG,murB murE-mraY-murD-spoVE-murG-murB 1592902..1592950 -9.1 ACAAACGGCAUCAUAGUAUGCCGUUUGUUUUGGAAUAG proposed 1391053 (Henriques et al., Biochimie 74:735-748, 1992); 8106328 (Harry et al., J. Bacteriol. 176:1172-1179, 1994); 1391053 (Henriques et al., Biochimie 74:735-748, 1992) Dubious; other proposed (readthrough) terminators are TTGTCTTGAAGTAAATCGGCAGCCCTAATGACTTTAAGCTTGGGGTGTCGATTGCTTTGACTACTA at 1589661..1589726 downstream of murD; GCTACTCGAGGTATTAACGAATGTATTTCCAAGCCTCCTGTCTAACATGAAGCTTGGAAACAATTGATGCGATAACCCTG at 1590703..1590782 downstream of spoVE; GGAAACAATTGATGCGATAACCCTGTCCAACAAAACAGGGTTATCGTTATGTTATAGAGAAACTT at 1590856..1590920 downstream of spoVE. Internal promoter in front of spoVE.
divIB divIB ND ND ND ND ND
ftsA,ftsZ ftsAZ 1598263..1598318 -15.3 CUAAUGUAAAGGACAAAAUCGUUUUCGAUUUUGUCUUUUUUGUUUUUCUCU Northern blotting (2.5 kb transcript) 1624452 (Gholamhoseinian et al., J. Bacteriol. 1992, 174(14):4647-4656); 1569582 (Gonzy-Treboul et al., J. Mol. Biol. 224:967-979, 1992); 2108961 (Wu et al., J. Biol. Chem. 1990, 265(12):6845-6850)
spoIIGA,sigE,sigG spoIIGA-sigE-sigG 1605698..1605752 -16.3 GAAAAGCCUUUAAAACGAUGUUGUUUUAAAGGCUUUUCUAUUGAUUAU promoter probe vectors; integrational plasmids; lacZ transcriptional fusions 2459711 (Masuda et al., Proc. Natl Acad. Sci. USA 1988, 85(20):7637-7641); 1902213 (Sun et al., J. Bacteriol. 1991, 173(9):2977-2984); 2439490 (Kenney & Moran, J. Bacteriol. 1987, 169(7):3329-3339) internal promoter in front of sigG
pyrR,pyrP,pyrB,pyrC,pyrAA,pyrAB,pyrK,pyrD,pyrF,pyrE pyrRPBCAAABKDFE 1629281..1629360 -23.3 UAAAGAGGCUUCAAAGCCUUGCUGUACUUGAAAACAGGCUGUGAGGCCUGUUUUUUUAUUAAUCC Northern blotting (12 kb transcript) 8206849 (Turner et al., J. Bacteriol. 1994, 176(12):3708-3722); Genbank AJ000974; Genbank M59757 An alternative terminator CCUUGCUGUACUUGAAAACAGGCUGUGAGGCCUGUUUUUUUAU (dG = -20.9 kcal/mole) was found at position 1629306..1629348. Downstream of pyrR at position 1618225..1618289, the stem-loop CAGGTCTTTGTATGCCTCTTTGCGTAAAAAAGCAAAGAGGTTTTTTTATACAGTCATTGAGTCAT was found as part of a terminator-antiterminator structure, leading to a 0.65 kb transcript. Similarly, at position 1619694..1619753 downstream of pyrP, the stem-loop GCCCTCTATTTAACCATACCCCGAGTCTATCTTAGACCGGGGTTTTTTTTCAGCCTTAAG also belongs to a terminator/antiterminator structure, leading to a 2.3 kb transcript. In front of pyrR, another terminator-antiterminator was found.
cysH,cysP,sat,cysC,ylnD,ylnE,ylnF cysHP-sat-cysC-ylnDEF 1635371..1635423 -19.5 AAUAAGCCAGAGCAUACAAAUGCUCUGGCUUUUCUUUAUGCGGC Northern blotting (6.1 kb transcript) 11004190 (Mansilla et al., J. Bacteriol. 2000, 182(20):5885-5892); Genbank AJ000974
spoVM spoVM 1654841..1654900 -21.8 AUAAAAACGCCUGCCACAUAUCGGGGCAGGCGUUCAUUUUGUUAUACACGC downstream gene is in opposite direction 8231808 (Levin et al., Mol. Microbiol. 1993, 9(4):761-771); Genbank Y13937
rnc,smc,ftsY rnc-smc-ftsY 1670412..1670467 -16.4 AAAAAGGCCCCAACAUCUUGGGGCCUUUUUCUUUUUUAUC Northern blotting (5.5 kb transcript) 7584053 (Oguro et al., DNA Res. 1995, 2(2):95-100); 11021934 (Kakeshita et al., Microbiology 2000, 146(Pt.10):2595-2603) Bidirectional terminator. Internal promoter, 705 bp upstream from the ftsY translation start site, inside the smc gene, leading to a 1.7 kb monocistronic ftsY transcript.
ylqB ylqB 1670428..1670476 -16.9 AAAAAGGCCCCAAGAUGUUGGGGCCUUUUUCUUAAUCGUC Northern blotting (0.5 kb transcript) 15033535 (Serizawa et al., Gene 2004, 329:125-136) bidirectional terminator
ylxM,ffh ylxM-ffh ND ND ND 5' primer extension of the downstream ffh gene 8335643 (Honda et al., J. Bacteriol. 1993, 175(15):4885-4894)
rpsP,ylqC rpsP-ylqC 1673422..1673468 -11.9 UAAAAGGGAGAGGGCCGGCACCUCCCCUUUUUUUACACGCAA proposed 8335643 (Honda et al., J. Bacteriol. 1993, 175(15):4885-4894)
sucC,sucD sucCD 1681809..1681859 -20.8 AAAAAAGGGACAGCCGUCAAGGCUGUUCCUGCUUUUUCUAACAAAAG Northern blotting (2.2 kb transcript) 11976317 (Condon et al., J. Bacteriol. 2002, 184(10):2845-2849); Genbank AJ000975
smf smf 1682753..1682803 -8.6 ACAAACGGUAUUGUAAUAUUUAAUAAUAGUGAGGAUUUAAAGUUGCAUAUUGUUUUCUAUUUAAUUA ND ND
topA topA 1685031..1685069 -15.8 GUAGCGGUGAGCAGGGUCUUGCUCACCUUCUUUGUGUGUUAA proposed Genbank AJ000975
codV,clpQ,clpY,codY codV-clpQY-codY 1690179..1690235 -12.2 AAAAAGAACCCUUUUUGAGGGUUCUUUUUUUAUUUCAAA plasmid integrations and in-frame deletion mutations 7783641 (Slack et al., Mol. Microbiol. 1995, 15(4):689-702)
flgB,flgC,fliE,fliF,fliG,fliH,fliI,fliJ,ylxF,fliK,ylxG,flgE,Bsu1630a,fliL,fliM,fliY,cheY,fliZ,fliP,fliQ,fliR,flhB,flhA,flhF,ylxH,cheB,cheA,cheW,cheC,cheD,sigD,ylxL fc31 ND ND ND RNAse protection assay; insertional mutagenesis; deletion of the promoter upstream of flgB 15175317 (Werhane et al., J. Bacteriol. 186(12):4025-4029, 2004); 8157612 (Marquez-Magana & Chamberlin, J. Bacteriol. 1994, 176(8):2427-2434); 9657996 (Estacio et al., J. Bacteriol. 1998, 180(14):3548-3555) Some readthrough into downstream rpsB. The terminator may be factor-dependent. Internal promoters in front of fliH, fliK, fliL, sigD.
ylxS,nusA,ylxR,ylxQ,infB,ylxP,rbfA ylxS-nusA-ylxRQ-infB-ylxP-rbfA 1736092..1736141 -17.7 AAAGAGAGGAUAGGCGUAUAUCGUCUGUCCUCUUUCUUCGUUUAUAA Northern blotting (5.2 kb transcript) 8491709 (Shazand et al., J. Bacteriol. 1993, 175(19):2880-2887) stem-loops AAAGAGTGGGGAAACCCGCTCTTT at 1731015..1731038 and CCCTGCTCTTTTGAAGCAGGG at 1731091..1731111 may have a regulatory function
mlpA mlpA 1743137..1743179 -17.9 GGAAAGCCUGCCCCAUAAUGGAGCAGGCAUUUUUUAAUCCCUUU proposed 8098035 (Chen et al., J. Biol. Chem. 268(13), 9448-9465, 1993)
ymxH ymxH 1743507..1743549 -15.0 UGAAACAUCGGCUGCCGGAGCCGAUGUUUUUUUAUAUGGAA proposed 8098035 (Chen et al., J. Biol. Chem. 1993, 268(13):9448-9465)
spoVFA,spoVFB,asd,dapG,dapA spoVFAB-asd-dapG-dapA 1748548..1748598 -15.6 AAACGCGGUCAUUCUCACAUUCAGCUGAGUUUGACCGUUUCUUUUACAUAUU primer extension analysis of dapG and dapA; integrative plasmids 8098035 (Chen et al., J. Biol. Chem. 268(13), 9448-9465, 1993); 8345520 (Daniel & Errington, J. Mol. Biol. 1993, 232(2):468-483) Internal promoter in front of asd. Second proposed terminator was found in a different section of the genome.
recA recA 1764966..1765022 -12.8 AAAAGGCUGAGUGAAAAACUCAGCUUUUUUGUAUUUUGC ND ND
pbpX pbpX ND -6.1 CACAUUUACAAUGAAGUUGUAACAUUUGUUUUUUUAACA proposed 14762009 (Cao & Helmann, J. Bacteriol. 2004, 186(4):1136-1146)
spoVS spoVS 1769462..1769521 -21.7 AUUCUCAACCUGUUUGCGUAAUGCAAACAGGUUGUUUUUCAUUUAUUGU Northern blotting (0.4 kb transcript) 7559352 (Resnekov et al., J. Bacteriol. 1995, 177(19):5628-5635)
cotE cotE 1774866..1774928 -16.8 AAAAAGGGACUAGGGGAGACAGUACCCCCAAGUCUCUUUUUUAUAUUGAUA proposed 8760914 (Ginetti et al., Microbiology 1996, 142(Pt.8):2021-2029)
mutS,mutL mutSL 1779499..1779542 -23.4 GGUAGGCAUUGAUCCAUUCUCUGAAUGGAUCAAUGCUUUUUUUGUACUCCU proposed 8760914 (Ginetti et al., Microbiology 1996, 142(Pt.8):2021-2029)
cwlC cwlC 1871938..1871986 -13.3 AAAAACCCGGCUCCUCAUCGCGAGAAACCGGGUUUUUUUAUUCAAGA upstream and downstream genes are transcribed in the opposite direction 8407798 (Kuroda et al., J. Bacteriol. 1993, 175(19):6260-6268)
spoVK spoVK 1874362..1874399 -20.0 CUGCAUAGACCUCUCAGUUUUUGAGAGGUCUGUUUUUUGCUCGUAUU proposed 1787791 (Foulger & Errington, Mol. Microbiol. 1991, 5(6):1363-1373)
glnR,glnA glnRA 1878958..1879003 -21.1 CUCAAUCCCUUGGCACUAAAAGUGUCAGGGGAUUUUUUAUGUUAAUA S1 nuclease mapping of the 5' and 3' end of the mRNA 2906311 (Strauch et al., Gene, 71(2):257-65, 1988); 6152242 (Fisher et al., Gene 1984, 32(3):427-438) A readthrough terminator, or alternatively a transcriptional pause site or RNA processing site, CCGTTTTCAAAGAGGGAATACATTCCGTCAAGGCGACATGTCCCGCTTCTTTCATTAATCCGTTAGCAACTGTTTTGCTATATACATTTTTACCTTTTAAGA was proposed downstream of glnR at 1877551..1877652. The S1 nuclease mapping of the 3' terminus showed that transcription ends in the TTTTTT stretch of the indicated terminator.
ynxB ynxB 1879734..1879794 -3.2 AAUAAGCCAAUGGGAAAAUUAAGGUUCUUUUUUUAUUUAACA proposed 2906311 (Strauch et al., Gene 1988, 71(2):257-65) Strauch et al. propose a different terminator further downstream.
xynP,xynB xynPB 1889576..1889629 -10.3 UUGCACAUGAAAAAGGAGAUUUCUAUUUUAGAACUCCUUUUUCAUAUGAGAA proposed; downstream gene is on the opposite strand (Hastrup, Genetics and Biotechnology of Bacilli, Vol. 2, pp. 79-83, 1988; no PubMed ID)
xylR xylR 1889670..1889709 -8.4 GACAGCUCAUCUUUAAAGAUGAGUUUUUUUAUUCUAGG proposed (Hastrup, Genetics and Biotechnology of Bacilli, Vol. 2, pp. 79-83, 1988; no PubMed ID); SubtiList
xylA,xylB xylAB 1894390..1894438 -16.5 AAAUAACCCCUCACAUUGACGUGAAGGGGUGUUUUUUAUUGUUACU proposed 1921970 (Jacob et al., Mol. Gen. Genet. 1991, 229(2):189-196)
cotC cotC 1904145..1904194 -13.5 UUUCCCCCGGCUAUUGCCGGGUCUUUUUUGUUUGUGCA proposed Sonenshein
yndG yndG ND ND ND ND ND
yndN yndN 1916723..1916782 -20.9 CUAUUCGGGCUCGCACCCAAAAGUCAGGGCGAGCCUGCUUUUUUUGAACAACA upstream and downstream gene are on the opposite strand 11244082 (Cao et al., J. Bacteriol. 2001, 183(7):2380-2383)
lexA lexA 1916784..1916826 -19.9 AAUAACCCCCUCUUCCUUUACGGAGAGGGGGUUUGUUGUUCAAAAA upstream and downstream genes are on the opposite strand 1657879 (Raymond-Denise et al., J. Bacteriol. 1991, 173(22):7084-7091) synonym: dinR
yneA,yneB,ynzC yneAB-ynzC 1918883..1918937 -17.2 UAUAAGAGGAAUACGGCAAUAUCGUAUUCCUCUUUUGCAUAUACUAU Northern blotting (1.3 kb transcript) 12581363 (Kawai et al., Mol. Microbiol. 2003, 47(4):1113-1122)
tkt tkt 1921075..1921117 -13.9 UGAAAGAGGAUGAGUCAAAUCAUCCUCUUUUUCUUGUUUAUC proposed 9068642 (Schiott et al., J. Bacteriol. 1997, 179(6):1962-1973)
yneE,yneF yneEF 1922002..1922045 -6.4 AAAAAACCCUUAUACGGGUUUUUUAUUUUGCAAU proposed 9068642 (Schiott et al., J. Bacteriol. 1997, 179(6):1962-1973) Bidirectional terminator
ynzD ynzD 1922012..1922057 -4.9 AAAAACCCGUAUAAGGGUUUUUUAUUUUAUAA proposed 9068642 (Schiott et al., J. Bacteriol. 1997, 179(6):1962-1973) bidirectional terminator
ccdA,yneI,yneJ ccdA-yneIJ 1924160..1924207 -12.2 AAAAACCUUUCCUCUUGUCAGGAAAGGUUUUUUAUUUGAGAA Northern blotting (1.8 kb transcript) 9068642 (Schiott et al., J. Bacteriol. 1997, 179(6):1962-1973); 10781554 (Schiott et al., J. Bacteriol. 2000, 182(10):2845-2854) bidirectional terminator. Internal promoters in front of yneI and yneJ, leading to a 0.9 kb yneIJ transcript and a 0.5 kb yneJ transcript respectively.
yneK yneK 1924166..1924216 -12.9 AAAAACCUUUCCUGACAAGAGGAAAGGUUUUUUAAUUCAUUU proposed; downstream genes are on the opposite strand 9068642 (Schiott et al., J. Bacteriol. 1997, 179(6):1962-1973) bidirectional terminator
cotM cotM 1924818..1924897 -15.7 AAAAAGUCACUUUCAUCCCCUAUUAUGAAAGUGACUUUUUUUCCGUCCAU downstream gene yneK, unlike cotM, is not induced during sporulation 9068633 (Henriques et al., J. Bacteriol. 1997, 179(6):1887-1897)
sspO,sspP sspOP 1925308..1925347 -5.9 AAAAGCAGACCUUAGUGUCUGUUUUUUUAUGCGUUC lacZ-sspP transcriptional fusion 10806362 (Cabrera-Hernandez, Gene 2000, 248(1-2):169-181) no transcriptional fusion experiment was performed for the downstream cotM gene
citB citB 1928618..1928660 -13.6 AGGAAGAGAAGGCAUUUCGCUUUCUCUUCUUUUUAUGACAC proposed SubtiList
yneN yneN 1929166..1929215 -9.4 AAAAACUGGAUCUUGAUUAGAUUCAGUUUUUUUUAUACUCA proposed 10333516 (Cabrera-Hernandez et al., Gene 1999, 232(1):1-10)
sspN,tlp sspN-tlp 1929895..1929936 -11.0 AAAAACCAGGGAAACCUGGUUUUUUUCUUUCUGA lacZ transcriptional fusion to tlp 10333516 (Cabrera-Hernandez et al., Gene 1999, 232(1):1-10)
alsT alsT 1939533..1939582 -18.4 ACAAAGCUGCAUUCAAUAGUUGAAUGCAGCUUUUUCAUUAUUGGA Northern blotting (1.5 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); SubtiList
bglC bglC 1941333..1941378 -14.5 UUUGGCGGACAUCAGUAACGAUGUCCGUUUUUAUCAUCUAAU proposed SubtiList
yngJ,yngI,yngH,yngG,yngF,yngE yngJIHGFE 1948846..1948889 -15.0 ACUUAGGAGCGCAAAAAAAGCGCUCCUUUAUAUAUUUACAA proposed 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)
yoxA,dacC yoxA-dacC 1997507..1997559 -13.3 GGAGACCUGUUUUCCAAGAGAAAACAGGUUUUUUUAUGUCUGU lacZ plasmids 9733705 (Pedersen et al., J. Bacteriol. 1998, 180(18):4967-4973)
gltA,gltB gltAB 2007724..2007772 -12.8 AGAAACCGGUCUGGCUGCCAGCCGGUUUCUUUUUUUAUUC Northern blotting (6.1 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
gltC gltC 2014878..2014937 -18.1 AUGAACCCGAGCUUCUAUAUAGAAGCUUCGGGUUUUUUUCUGCAAAU upstream and downstream genes transcribed in the opposite direction Genbank AF006720
yoxC,yoxB,yoaA yoxCB-yoaA 2020330..2020371 -12.9 AAAAAGCGCCCCUCAAACAGGGCGCUUUCUAAUUAAGAUG proposed 10482513 (Petersohn et al., J. Bacteriol. 1999, 181(18):5718-5724)
yoaF yoaF 2027014..2027064 -24.6 AAUCUGAGGAGAGCGAGAUUCAUUGUCACGCUCUCCUCUGUUUAGCUGUAUGGAU downstream gene is on the opposite strand 11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457)
yoaG yoaG 2027009..2027059 -23.4 AAACAGAGGAGAGCGUGACAAUGAAUCUCGCUCUCCUCAGAUUUGUUUUAUUCACC downstream gene is on the opposite strand 11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457)
yoaH yoaH 2028582..2028635 -22.6 CUUACGUGCAACCCCCAUCUUAUUCGGUGGGGGUUGGCUACUUUUACUGUGGUUGU Northern blotting (1.6 kb transcript) 15033535 (Serizawa et al., Gene 2004, 329:125-136); Genbank AF027868 Serizawa mentions that the terminator is downstream of yoaH; in the Genbank sequence, the terminator overlaps the gene.
yoaJ yoaJ 2032099..2032147 -10.6 CGAAACAGCGGAUCUUUUCCCGCUGUUUUUUCAAUGUUCU proposed 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629)
yoaN yoaN 2036694..2036738 -11.1 UAAAUCCCUAUAUAUACGUUAUGUAGGGUUUUUCUGCUUGAAU Northern blotting (1.2 kb transcript) 14973022 (Costa et al., J. Bacteriol. 2004, 186(5):1462-1474); Genbank AF027868
yoaW yoaW 2046108..2046158 -15.3 GCCAAGCUAAUGUCUACAUGCAGACAUUAGCUUUUUUCAUUGUUUA downstream gene is in the opposite direction Genbank AF027868
xynA xynA 2053273..2053326 -9.2 UAAUAGAAUGGUAUUUAAAUGAGAAUGCUAUCAAUUUUUUGUAGUCAGC Northern blotting (1.0 kb transcript) 8628241 (Allmansberger, Mol. Gen. Genet. 1996, 251(1):108-112) Genbank Z34519 suggests the terminator TGGAAATTAAGAAAAGAACCTGGTGAAATTTCCCAGGTTCTTTTTATATTGCAC (dG = -23.6 kcal/mole) at position 2053273..2053326, which does not agree well with the measured mRNA length.
phrK phrK 2062613..2062651 -15.8 AUUUAGCCCUACUCAAACAUUUGAGUGGGCUUUUAUUUUAUGAUU downstream yobH gene is transcribed in the opposite direction 11466295 (McQuade et al., J. Bacteriol. 2001, 183(16):4905-4909) no terminator identified in Genbank AF027868
yobJ yobJ 2069346..2069390 -18.7 CUAGGUAGGCCUAUCCCUUCAGGUUCUGAGGCUCAAGGGAGGUCUAUUUUUUCUAUAUACG proposed 9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371) Genbank AF027868 does not list a terminator
yobO yobO ND ND ND downstream genes are on the opposite strand ND
yobW yobW ND ND ND upstream and downstream genes are in the opposite direction 8990290 (Henriques et al., J. Bacteriol. 1997, 179(2):389-398)
des des 2089656..2089709 -18.9 AUAAAGGAGGUCUUCUAAUAUACUAGAAGGCUUCCUUUUUAUUGUUGGAG Northern blotting (1.1 kb transcript) 10559169 (Aguilar et al., J. Bacteriol. 1999, 181(22):7028-7-33)
yocF,yocG yocFG 2091498..2091551 -19.7 AAAAAGGAUCUUGGCAUCUGCCAGGAUCCUUUUUGUUAACCUGA Northern blotting (1.9 kb) 11285232 (Aguilar et al., EMBO J. 2001, 20(7):1681-1691); Genbank AF027868 synonym: desKR
bsrB bsrB 2095108..2095154 -16.3 CGAAAGCCAUUUCCUUUUCGGAAAUGGCUUUUUAUUUUAUCUA Northern blotting 11886746 (Ando et al., FEMS Microbiol. Lett. 2002, 207(1):29-33) RNA gene
yocK yocK 2096292..2096337 -13.2 GCCAAGCAAGUACACCGAUAUUAGAUGUACUUGCUUUUUUUUGAAAAAA Northern blotting (0.5 kb transcript) 10220166 (Petersohn et al., Microbiology 1999, 145(Pt.4):869-880); Genbank AF027868
yozO yozO 2098572..2098615 -14.1 UGAUGAGCCAGCCGUUCAAAAAAUGGUUAGGCUUUUUUUAUAUAUAAA downstream gene is on the opposite strand 11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457)
odhA,odhB odhAB 2106674..2106727 -21.3 AAAAAGGGUACAUCACGAUAAAGUGAUGUACCCUUUUUGAUGCAUAUU Northern blotting (4.3 kb transcript) 11976317 (Condon et al., J. Bacteriol. 2002, 184(10):2845-2849); Genbank M27141
yodF yodF 2131052..2131102 -18.4 AAAAACCAUACGCGGCAGCCGCGUAUGGUUUUUUUUACAUUUC Northern blotting (1.8 kb transcript); upstream and downstream genes are on the opposite strand 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
cgeC,cgeD,cgeE cgeCDE 2144968..2145012 -18.8 AAAUUUCAAAAGAGCCUUCCUUAUUAGGAAGGCUCUUUUUAUGUGAAAAA Northern blotting (2.7 kb transcript) 7592393 (Roels & Losick, J. Bacteriol. 1995, 177(21):6263-6275); SubtiList potential readthrough terminator is located downstream of cgeC, leading to a 0.4 kb monocistronic cgeC transcript.
cgeA,cgeB cgeAB 2149215..2149269 -10.6 AAAAAUCGUUCAUUGCUAUGAACGAUUUUUUUAUUCAUAG Northern blotting (1.4 kb transcript) 7592393 (Roels & Losick, J. Bacteriol. 1995, 177(21):6263-6275) A shorter 1.0 kb transcript was also detected, which may be due to a terminator inside the cgeB coding region, or a processing or degradation product of the 1.4 kb transcript.
phy phy 2149271..2149317 -10.3 AGAAAGCAGCUUGUGCAGCUGCUUUUUUCUAUGAAUA proposed 7592393 (Roels & Losick, J. Bacteriol. 1995, 177(21):6263-6275)
yotK yotK ND ND ND ND ND
sspC sspC 2155646..2155688 -14.7 UUUAUGAGGGGGAUAAUUCCCCUCUCUUUUUUAAGUCUUCU Northern blotting (0.29 kb transcript) 2981806 (Connors & Setlow, J. Bacteriol. 1985, 161(1):333-339)
ypqP ypqP 2286244..2286301 -17.0 AAAAACAAGCCUGUCUAUCCAUUAGGCAGGCCUGUUUUUAACAGUUUAU proposed; downstream genes are on the opposite strand Genbank L77246 bidirectional terminator
yppQ yppQ 2286246..2286302 -16.0 AAAAACAGGCCUGCCUAAUGGAUAGACAGGCUUGUUUUUAUGCCUUUUU proposed; downstream genes are on the opposite strand Genbank L77246 bidirectional terminator
ypoP ypoP 2287798..2287851 -16.4 AAAAAGCACAUACCGAUAUAUAGGUAUGUGCUUUUCGCAGUGCUUC proposed; upstream and downstream genes are on the opposite strand Genbank L77246 bidirectional terminator
ypnP ypnP 2287816..2287858 -15.7 GAAAAGCACAUACCUAUAUAUCGGUAUGUGCUUUUUUUCACCGUUU proposed; downstream gene is on the opposite strand Genbank L77246 bidirectional terminator
ypmT ypmT 2289240..2289284 -7.2 AAAAAGAGACAUGAAACAACGUCUCUUUUUUCGUGUGGUC proposed Genbank L77246
ilvA,ypmP ilvA-ypmP 2291545..2291624 -30.8 UUUUACCUGCAUGCCCUCCUUUGUAAUCGUUAAUGGGGAGGCAUGCAGGAUUUUUUUUGCUCAGU Northern blotting (1.6 kb transcript) 15060025 (Mader et al., J. Bacteriol. 2004, 186(8):2240-2252) internal promoter in front of ypmP, leading to a 0.25 kb transcript.
yplQ yplQ 2295137..2295181 -16.8 GAAAAGCGCAGUCUUCACGACUGCGCUUUUUUAUGCACGUA proposed; downstream genes are on the opposite strand Genbank L77246 bidirectional terminator
ypkP ypkP 2295139..2295198 -17.5 AAAAAGCGCAGUCGUGAAGACUGCGCUUUUCUGUUACUGUU proposed; downstream genes are on the opposite strand Genbank L77246 bidirectional terminator
ypjQ ypjQ 2297138..2297186 -12.3 AAAAAUCAUUUCUGGGUUCAGAAAUGAUUUUUUAUUGUGUUA proposed Genbank L77246
ypiP ypiP 2298580..2298613 -17.0 AACAAGCCCGUGAUUCAUAUCACGGGCUUUCUGUUAAUCGGU proposed Genbank L77246
yphP yphP 2299390..2299425 -11.8 CUAAAUGCCCGUUCUCCGGGCAUUUUCUUUUUGGGAG proposed Genbank L77246
ilvD ilvD 2299844..2299912 -31.9 GUGAACAUUUGAAAUCCGGCCCUCUCUAUAGUAUCCUUUACUUCAGAUGAAGGAUACUAGAGGGGGCUUUUUUUAUGUCAAU Northern blotting (1.8 kb transcript) 15060025 (Mader et al., J. Bacteriol. 2004, 186(8):2240-2252); SubtiList
ypgR ypgR 2301886..2301941 -11.4 AAAAAGGUGCAGAUCAUGCACCUUUUUUAUGUGAAUU proposed Genbank L77246
metA metA 2305453..2305490 -12.9 AGCCAGUGAAUCGCUGGAAAGCGCAUGCCACAUUAUUGUUUAUGAAU proposed Genbank L77246 The Genbank record shows CCAAGAAACTCCTTATGAATGGGACTAATTTTTCTTTT (dG = -5.0 kcal/mole) as the proposed terminator. An open reading frame can be found in front of this second terminator.
degR degR 2307326..2307367 -19.3 CAAAUAGGAGAGGCGAAUGCCUCUCCUCUAUUUGUCAUCUCAUCA upstream and downstream genes are in the opposite direction 3082853 (Nagami & Tanaka, J. Bacteriol. 1986, 166(1):20-28)
ypeQ ypeQ 2307953..2308008 -10.0 AAAAACCGCAGAAGCUGCGGUUUUUAUUCUUUGAA proposed; downstream gene is on the opposite strand Genbank L77246
sspL sspL ND ND ND downstream gene is transcribed in the opposite direction 10333516 (Cabrera-Hernandez et al., Gene 1999, 232(1):1-10)
ypcP ypcP 2310160..2310216 -22.1 CUGAACGCUAGAGAGAUCGUUUAGAUCCUCUCUAGCGUUUUGUAUUGCUUUU proposed; downstream genes are on the opposite strand ND Genbank L77246 proposes the terminator CGGAGTAACACCGCCGGTCAGCCGGCCTTTATCTTTCTT (dG = -10.0 kcal/mole) further downstream at position 2310062..2310100 instead. The indicated terminator was found by mfold.
ypbS ypbS 2311136..2311179 -15.4 UCAAACAGUAUCUCUAAUUAAAGAGAUACUGUUUUUUAUUUUUGGG proposed Genbank L77246
xpt,pbuX xpt-pbuX 2317300..2317339 -11.0 UCUAACUCCGCCGCGGCGGAGUUUUUUUUGCAUAUA Northern blotting (2.1 kb transcript) 9098051 (Christiansen et al., J. Bacteriol. 1997, 179(8):2540-2550)
ypwA ypwA ND ND ND proposed ND The terminator proposed in Genbank L77246 was not found using mfold.
kdgR,kdgK,kdgA,kdgT kdgRKAT ND -15.5 AAAAAGGCUGCCACAAAACAUACCGGCAGCCUUUUAUACAAACAAU Northern blotting (3.7 kb transcript) 9846747 (Pujic et al., Microbiology 1998, 144(Pt.11):3111-3118)
ypvA ypvA 2326646..2326693 -14.4 AAAAAGCUGACGAUCGUUCGUCAGCUUUUUUAUUUGUCAG proposed Genbank L47838 This gene is referred to as ypuA in the Genbank file
cotD cotD 2331908..2331946 -14.9 ACAAAUGGGGCCCACGGGAGCCCCAUUUUUUAAAGCAGGU experimental Genbank L47383 Genbank L47838 lists experimental evidence for this terminator, but does not specify the evidence further.
sspM sspM 2338954..2339004 -17.1 CGUAAGAAGCAAGGAAUUUCCUUGCUUCUUUAUUUUUUCAGCC upstream and downstream genes are transcribed in the opposite direction 10806362 (Cabrera-Hernandez, Gene 2000, 248(1-2):169-181)
recU,ponA recU-ponA 2343370..2343425 -18.6 AAAAAGCCGUCACCUUUGGGGUGAUGGCUUUUUUGGUACACAA lacZ transcriptional fusions 7814321 (Popham & Setlow, J. Bacteriol 1995, 177(2):326-335); Genbank L47838
ypjB ypjB 2360704..2360754 -14.7 UGAGGGGCGGCGGUCAGCCGCCUUUUUUCUAUUACAU downstream gene in in the opposite direction 8760912 (Sorokin et al., Microbiology 1996, 1442(Pt.8):2005-2016) Genbank L47709
qcrA,qcrB,qcrC qcrABC 2362220..2362272 -10.3 CAAAAGCUGACCCGGCGUCAGCUUUUUUAUAUGGACA Northern blotting (2.0 kb transcript) 7592464 (Yu et al., J. Bacteriol. 1995, 177(23):6751-6760)
trpE,trpD,trpC,trpF,trpB,trpA,hisC,tyrA,aroE trpEDCFBA-hisC-tyrA-aroE 2367127..2367179 -14.6 AAAAAUCCUGAAGUUUUACUUCAGGAUUUUUUAUGCAGAUC integrative plasmids to interrupt transcription 3106153 (Henner et al., Gene 1986, 49(1):147-152); 3924737 (Henner et al., Gene 1985, 34(2-3):169-177); 11566976 (Babitzke & Gollnick, J. Bacteriol. 2001, 183(20):5795-5802) transcription starting from the promoter in front of aroF leads to an aroFBH-trpEDCFVA-hisC-tyrA-aroE transcript and an aroFBH transcript, terminating at the terminator-antiterminator structure in front of trpE. An internal promoter may exist upstream of hisC.
mtrA,mtrB mtrAB 2383662..2383696 -3.9 CAAACAGCGGGAGGAUACAGCCAAUUCUUUUUUUUAUGCUAUAA plasmid-mediated homologous integration of overlapping DNA fragments of the mtr region 2123343 (Gollnick et al., Proc. Natl Acad. Sci. USA 1990, 87(22):8726-8730)
hbs hbs 2384655..2384717 -13.0 GAAAAGCCCCUUUCUAAGGGGCUUUUCAUAUUUCAAG Northern blotting (0.38 kb and 0.54 kb transcripts) 1902464 (Micka et al., J. Bacteriol. 1991, 173(10):3191-3198)
spoIVA spoIVA 2385351..2385386 -12.2 CGGUAGACCUCUUUAUAGAAUGGGAGGUCUUUUUUCUUUGCUCU Northern blotting (1.6 kb transcript) 1729246 (Roels et al., J. Bacteriol. 1992, 174(2):575-585); 1729247 (Stevens et al., J. Bacteriol. 1992, 174(2):586-594) mfold found a stronger stem-loop TGTTACTCTACATACAGAAATTCTTCACTTTGTTGGACAAACATTCCTCAGAGTGCAGTTTTTCTTAAAAAGCCGTTTAATTGTCTTTCTCTTACTTGCT with dG = -16.4 kcal/mole at position 2385115..2385214 further downstream. There may be another gene between spoIVA and this stem-loop.
sleB,ypeB sleB-ypeB 2396924..2396974 -4.8 GGAAAGGACUAAAUGUCUUUUCCUUUUUUUCAU Northern blotting (2.2 kb transcript) 10197998 (Moriyama, J. Bacteriol. 1999, 181(8):2373-2378); 8760912 (Sorokin et al., Microbiology 1996, 142(Pt.8):2005-2016)
serA serA 2411846..2411896 -12.6 AAAAACUCAAGCUAUAUAGCUUGAGUUUUUUUAUUGUUCU Northern blotting (1.6 kb transcript); upstream and downstream genes are on the opposite strand 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); Genbank L47648 bidirectional terminator
aroC aroC 2411856..2411923 -12.6 AAAAACUCAAGCUAUAUAGCUUGAGUUUUUUUAAUUAUGG Northern blotting (0.9 kb transcript); downstream gene is on the opposite strand 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); Genbank L09228 bidirectional terminator
sigX,rsiX sigX-rsiX 2412750..2412811 -8.6 AAAAAGAGCCCUUUAAGGCUCUUUUUUAGUUGCUAU Northern blotting (1.8 kb transcript) 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); Genbank L09228
resA,resB,resC,resD,resE resABCDE 2414539..2414582 -16.9 AGAAACACCCGCUGACUGAGCGGGUGUUUUUUUAAUAGCCA Northern blotting 8631715 (Sun et al., J. Bacteriol. 1996, 178(5):1374-1385); 7934829 (Sorokin et al., Mol. Microbiol. 1993, 10(2):385-395); 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405) Internal promoter in front of resD, leading to a 2.5 kb transcript. Azevedo found a 7.0 kb transcript that started upstream of ypuL (in front of resA), as well as a shorter 0.7 kb transcript corresponding to ypuL only. The transcripts detected by Azevedo and Sun both had a length of 7 kb, which is 1 kb longer than needed for a resABCDE operon. In addition, Azevedo found that a probe for ypuL hybridizes to the 7 kb transcript, indicating that the transcript corresponds to ypuL-resABCDE. Such a transcript agrees well with the length of 7 kb measured by Northern blotting. However, Sun's primer extension experiment showed a single promoter just in front of resA.
dacB,spmA,spmB dacB-spmAB 2421439..2421495 -8.3 GUUACGUUAUUAUUUGGGAGCGCCUGAAAACGGCGUUUUUUUUAGAUUUG lacZ transcriptional fusions 7642500 (Popham et al., J. Bacteriol. 1995, 177(16):4721-4729); 7934829 (Sorokin et al., Mol. Microbiol. 1993, 10(2):385-395); SubtiList Sorokin et al. propose the alternative terminator TGAAAACGGCGTTTTTTTTAGAT (dG = -0.3 kcal/mole) at position 2421435..2421457).
ypuG,ypuH,ypuI ypuGHI 2423809..2423847 -14.7 GUUUACUCUCCCUUUUUCAGGGAGAGUUUUUUUAUGUUUGC Northern blotting (2.0 kb transcript) 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); 1548223 (Buchanan & Ling, J. Bacteriol. 1992, 174(6):1717-1725) Internal promoter in front of ypuI, leading to a 0.5 kb transcript.
ypuF ypuF 2426546..2426604 -16.6 AAAAAAAGCAGAGACUGAUCACAGCCUCUGCUUAAUUAUUGUAUGAAAUG proposed Genbank L09228 bidirectional terminator
ypuE,ribD,ribE,ribA,ribH,ribT ypuE-ribDEAHT 2426567..2426618 -17.0 AUUAAGCAGAGGCUGUGAUCAGUCUCUGCUUUUUUUUCUGCGUU Northern blotting (4.3 kb transcript); nuclease protection mapping of the 5' end 8159171 (Mironov et al., Mol. Gen. Genet. 1994, 242(2):201-208); 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); (Perkins et al., J. Ind. Microbiol. Biotechnol. 1999, 22(1):8-18; no PubMed ID); 2112225 (Mironov et al., Mol. Biol. (Mosk.) 1990, 24(1):221-225; Molekulyarnaya Biologiya 1990, 24(1):256-261); Genbank L09228 Bidirectional terminator. Internal promoters in front of ribA and ribT, leading to a 2.4 kb and a 0.4 kb transcript. The original papers do not mention the existence of the ypuE gene, which partly overlaps ribD. The promoter site that was found experimentally for ribD lies upstream of ypuE. Just upstream of ribD is a putative terminator/antiterminator structure. Azevedo also finds a 0.16 kb ypuE-specific transcript.
ypuD ypuD 2430890..2430941 -19.4 AAAAACAUCACCUUUCGGAUCGAAGGGUGAUGUUUUGUUUUUCUCAA Northern blotting (0.6 kb transcript) 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); Genbank L09228
sipS sipS 2431473..2431529 -13.1 AUCAAGCAGCUUCCCAUUGGGGCUGCUUUUUUUAUAUCUUU Northern blotting (1.2 kb and 0.45 kb) 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); 8951809 (Bolhuis et al., Mol. Microbiol. 1996, 22(4):605-618); Genbank L09228 Azevedo found two transcripts, which correspond to the two transcription start sites found by Bolhuis.
ypuB,ypuC ypuBC 2432900..2432942 -16.5 CGAGUGAUGUUGCUGCGGGUUACGCCUUCGGCGGUGUUUGGCUGAGUUUGAAUGUUUUGGU proposed 10482513 (Petersohn et al., J. Bacteriol. 1999, 181(18):5718-5724); 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405) In a Northern blotting experiment, Azevedo found a 1.2 kb transcript covering ypuB and ypuC, but starting far upstream of ypuB.
ppiB ppiB 2434508..2434556 -15.7 AAAAGGCUUCCUCUUAGAGAGGAAGCUUUUUUUAUUGGCCA Northern blotting (0.5 kb transcript); upstream and downstream gene are on the opposite strand 8022278 (Herrler et al., Mol. Microbiol. 1994, 11(6):1073-1083); 7934829 (Sorokin et al., Mol. Microbiol. 1993, 10(2):385-395); 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405)
ypuA ypuA 2436090..2436143 -10.7 AAAAGCGCCGAAAAAUCGGCGUUUCUUUUAUUGCUU Northern blotting (0.8 kb transcript); upstream and downstream genes are on the opposite strand 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); Genbank L09228 bidirectional terminator
spoVAA,spoVAB,spoVAC,spoVAD,spoVAE,spoVAF,lysA spoVAABCDEF-lysA 2436105..2436149 -11.5 AGAAACGCCGAUUUUUCGGCGCUUUUCUUAUUUGAAU integrational plasmids; Northern blotting; downstream gene is in the opposite direction 3926949 (Fort & Errington, J. Gen. Microbiol. 1985, 131(Pt.5):1091-1105); 7934830 (Azevedo et al., Mol. Microbiol. 1993, 10(2):397-405); BSORF, Genbank L09228 The integrational plasmids showed that at least spoVAA through spoVAE belong to the same operon. The coding regions of spoVAE and spoVAF overlap. No terminator was found between spoVAF and lysA (Genbank L09228). Azevedo et al. found a 2.3 kb transcript orginating about 1 kb upstream of the lysA start codon, suggesting that transcription of spoVA continues into the lysA gene. However, the BSORF database contains a transcript consisting of the spoVA genes only. The lysA gene is also transcribed monocistronically as a 1.3 kb transcript.
dacF,spoIIAA,spoIIAB,sigF dacF-spoIIAAB-sigF 2442592..2442641 -17.1 GGAUGGCUAGUCUGCAGUGCAGGCUAGCUUUUUUGUGCAAAAG Northern blotting (2.9 kb transcript) 2492512 (Wu et al., J. Bacteriol. 1989, 171(2):692-698); 1629150 (Wu et al., J. Bacteriol. 1992, 174(15):4885-4892); BSORF Internal promoter in front of spoIIAA, leading to a 1.7 kb transcript.
drm,punA drm-punA 2445546..2445598 -20.2 CAAAAGACAGCUGUGUCUGAUAUCACACAGCUGUCUUUUUUUAUGCCCAA Northern blotting (2.1 kb transcript); transcriptional fusions 10537218 (Schuch et al., Microbiology 1999, 145(Pt.10):2957-2966) Northern blotting results in BSORF show a drm-punA, a ripX-drm-punA, and a fur-ripX-drm-punA transcript. Wu et al. (1629150) consider a monocistronic punA transcript.
fur fur 2448982..2449026 -11.7 GCGAACCUUUUCUCAUGGGGAAAGGGUUUUUUGCUGUUUCU proposed 12029044 (Fuangthong et al., J. Bacteriol. 2002, 184(12):3276-3286); SubtiList Northern blotting results in BSORF show a fur-ripX-drm-punA transcript and a monocistronic fur transcript.
spoIIM spoIIM ND ND ND Northern blotting 8501065 (Smith & Youngman, J. Bacteriol. 1993, 175(11):3618-3627); BSORF
ansA,ansB ansAB ND ND ND 5' primer extension analysis of ansB 1711029 (Sun & Setlow, J. Bacteriol. 173(12), 3831-3845, 1991) Northern blotting results in BSORF show an ansAB, an ansAB-yqkIJK, a nudF-yqxK-ansAB, and a nudF-yqxK-ansAB-yqkIJK transcript. The stem-loop UUGUAUAAAAUACAGCUUAUUCAUCUCCGAAUAGUCGGAUGAAUAAGCUGUUUA at position 2453478..2453531, suggested by Sun & Setlow, is missing a T-stretch.
ansR ansR 2456662..2456707 -5.4 GAACAGCCAUUUCUGUUCCGAAGGCUUUUUUUAGUUUGUC Northern blotting; upstream and downstream genes are on the opposite strand 8478318 (Sun & Setlow, J. Bacteriol. 1993, 175(9):2501-2506); BSORF Northern blotting results in BSORF suggest that ansR is transcribed in the opposite direction as part of the nudF-yqxK-ansAB and the nudF-yqxK-ansAB-yqkIJK transcripts. Sun et al. propose the terminator ACAGGAGGAACTGAGTTAATCTTTAGCTCACGGTTTAATTTTACCGTAGGTTCCTCCTC in this region; however, this secondary structure is not recognized by mfold and lacks a T-stretch.
yqkF yqkF 2459429..2459476 -18.8 AAAAACCAGCACCUGUACGGGUGCUGGUUUAUUUAUAUUGAU Northern blotting; upstream and downstream gene are on the opposite strand BSORF
yqkE yqkE 2459163..2459217 -16.2 AUAAACCAGCACCCGUACAGGUGCUGGUUUUUCUGCUAUGAG Northern blotting; upstream and downstream gene are on the opposite strand BSORF
yqkD yqkD 2460762..2460811 -7.6 CGAAAGGCCUCUUCGGCUCUUUCGCUUUUUUAUG Northern blotting; upstream and downstream genes are on the opposite strand BSORF; SubtiList
yqjY,yqjZ,yqkA,yqkB,yqkC yqjYZ-yqkABC 2460766..2460817 -17.9 AAAAAGCGAAAGAGCCGAAGAGGCCUUUCGCUUUUUUAUUCUGUUG Northern blotting BSORF Northern blotting results in BSORF suggest the existence of internal promoters in front of yqkB and yqkC
yqzH yqzH ND ND ND Northern blotting BSORF
yqjV,yqjU yqjVU ND ND ND Northern blotting BSORF
yqjP,yqjQ,dsdA,coaA,yqjT yqjPQ-dsdA-coaA-yqjT 2467141..2467179 -14.4 GUUUGCGGGAGAGAUUCAUUCUCUUCCGUUUUUUAUUUAAAGC Northern blotting BSORF Northern blotting results in BSORF suggest the existence of an internal promoter in front of coaA
proI proI 2473180..2473221 -15.7 AAAAACAGAAGGCACAGUGCCUUCUGUUUUUUAUUUUUCCC Northern blotting; upstream and downstream gene are on the opposite strand BSORF; SubtiList
yqjN yqjN 2473185..2473233 -15.7 AAAAACAGAAGGCACUGUGCCUUCUGUUUUUGUCCUUACAU Northern blotting; upstream and downstream gene are on the opposite strand BSORF
yqjM yqjM 2476045..2476088 -15.9 CAUAAGAGAUAUCCUGUAGAGGAUAUCUCUUUUUUUAUUUUUAG Northern blotting BSORF; SubtiList
yqjL yqjL 2476935..2476969 -8.7 AGACCGGGCCGUAAGGGAUUCCCGGUCUUUUAUAUUAUUUUGU Northern blotting; downstream gene is on the opposite strand BSORF
yqjK yqjK 2476799..2476847 -14.3 UAAAAGACCGGGAAUCCCUUACGGCCCGGUCUUUUUUUACGUUAAU Northern blotting; upstream and downstream genes are on the opposite strand BSORF
zwf zwf 2479803..2479861 -17.8 AAAAAGCCGAAAAUGUUUACAAGCAUUUUCGGCUUUUUUACGCUGAAC Northern blotting; upstream and downstream genes are on the opposite strand BSORF; SubtiList
yqjH,yqjI yqjHI 2479892..2479942 -21.0 AGAAACCCCCGAAGCUCUUAAGCUUUGGGGGUUUUGUUAUUAAGGA Northern blotting BSORF; SubtiList Northern blotting results in BSORF suggest the existence of an internal promoter in front of yqjI
yqjG yqjG 2483903..2483958 -18.7 AAAAGCAACCCCGUGCAAAAAGCCGGGGUUGUUUUUUGUUACUUGC Northern blotting BSORF; SubtiList
yqiW yqiW 2492210..2492265 -15.4 AACAACCCGGAUGCUCAAAGCAGCCCGGGUUUUUUUGUGCAUAA Northern blotting BSORF; SubtiList
bmrU,bmr,bmrR bmrU-bmr-bmrR 2495931..2495984 -19.9 AAAAAGAGCAUUUUUUGAAACAAAACUUCAAAAAAUGCUCUUUUUGCUUAUUUAG Northern blotting (3.8 kb transcript) 10220166 (Petersohn et al., Microbiology 1999, 145(Pt.4):869-880); 7961792 (Ahmed et al., J. Biol. Chem. 1994, 269(15):28506-28513); BSORF Bidirectional terminator. Readthrough terminator downstream of bmrU leads to a 1.0 kb transcript. Readthrough terminator CAGCACGTGATAAGAAGCGCATTCTTTGTGTACTGCAAAGAATGCGCTTCTTCTTTATACTGATGATAG with dG = -29.1 kcal/mole at position 2495007..2495075 leads to a 2.5 kb transcript. Internal promoter in front of bmr.
ptb,bcd,buk,lpdV,bkdAA,bkdAB,bkdB ptb-bcd-buk-lpdV-bkdAABB 2495924..2495981 -27.3 CAAAAAGAGCAUUUUUUGAAGUUUUGUUUCAAAAAAUGCUCUUUUUCUAUGCUUUAUU Northern blotting (7.9 kb transcript) 15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107); 8504804 (Wang et al., Eur. J. Biochem. 1993, 213(3):1091-1099) Bidirectional terminator. Northern blotting results in BSORF show various transcripts in this region. Northern blotting experiments by Yoshida (12823818) show a 8.7 kb bkdR-ptb-bcd-buk-lpdV-bkdAA-bkdAB transcript. Nickel also found a 10.2 kb bkdR-ptb-bcd-buk-lpdV-bkdAA-bkdAB-bkdB transcript due to readthrough at the terminator downstream of bkdR.
bkdR bkdR ND ND ND Northern blotting (2.1 kb transcript) 15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107) Nickel also found a 10.2 kb bkdR-ptb-bcd-buk-lpdV-bkdAA-bkdAB-bkdB readthrough transcript. Northern blotting experiments by Yoshida (12823818) show a 8.7 kb bkdR-ptb-bcd-buk-lpdV-bkdAA-bkdAB transcript.
yqzF yqzF 2506437..2506486 -14.9 AAAAAGCCGGAGAAUGCUCCGGCUUUUUUUGUUGCAUU Northern blotting; upstream and downstream genes are on the opposite strand BSORF
mmgA,mmgB,mmgC,mmgD,mmgE,yqiQ mmgABCDE-yqiQ 2506452..2506498 -13.4 AAAAAGCCGGAGCAUUCUCCGGCUUUUUUUCAGCUAUC lacZ transcriptional fusion; Northern blotting 8759838 (Bryan et al., J. Bacteriol. 1996, 178(16):4778-4786); BSORF; SubtiList The transcriptional fusion shows that the operon includes mmgE, but does not exclude the possibility that genes further downstream are also included. Eichenberger (12662922) also includes the downstream yqiQ as part of the operon. The Northern blotting results in BSORF show a mmgABCDE-yqiQ transcript.
yqiG yqiG 2516729..2516784 -18.9 GCAAAGACUGCCGAAACGAUUCGGCAGUCUUUUUUCCCUUUAUA Northern blotting; upstream and downstream genes are on the opposite strand BSORF; SubtiList
spo0A spo0A 2517157..2517253 -21.1 GUCAUUAAAUCAAACGUCUUUUAUUUAUUAGUUUGCGCUGAUAAAUAGGAGGCGUUUUGUUUUGGGGAC S1 nuclease mapping; Northern blotting 3157992 (Ferrari et al., Proc. Natl Acad. Sci. USA 1985, 82(9):2647-2651); BSORF The S1 nuclease mapping experiment showed that transcription terminates at the seventh nucleotide in the T-stretch UUUUGUUUUGGGG.
spoIVB spoIVB 2518305..2518360 -16.0 GCUGACUGCCGGAGUUUCCGGCAGUUUUUUUAUUUUGAU Northern blotting 2106508 (Van Hoy & Hoch, J. Bacteriol. 1990, 172(3):1306-1311); BSORF
ahrC,recN ahrC-recN 2519759..2519804 -16.2 GGUAAGCUGCGCGAGAAGCGCAGCUUAUUUUUUUCGUGC proposed 2106508 (Van Hoy & Hoch, J. Bacteriol. 1990, 172(3):1306-1311) Northern blotting results in BSORF show an ahrC-recN transcript, a yqiBCDE-yqxC-ahrC-recN transcript, and a yqiE-yqxC-ahrC-recN transcript.
yqxC yqxC 2522079..2522118 -12.2 GUACCGGAAUAAUAGGGCGCUAUUAUUCCUUUUUUCUGCAUUCA proposed 2507400 (North et al., Gene 1989, 80(1):29-38)
nusB,folD nusB-folD 2527534..2527575 -9.0 ACCCGCUUCUUCAGGCUCCUAAAGCCAGGGCGGGUUUUCUUUAGUUAUG proposed 11591660 (Saxild et al., J. Bacteriol. 2001, 183(21):6175-6183) Northern blotting results in BSORF show various transcripts in this region.
accB,accC,yqhY accBC-yqhY 2529111..2529154 -4.0 CCAAGGGGAGGGCGGCCCUUUGGUUUUUUUACA Northern blotting (2.9 kb transcript) 7592499 (Marini et al., J. Bacteriol. 1995, 177(23):7003-7006); BSORF Northern blotting results in BSORF also show a accBC-yqhY-nusB-folD readthrough transcript.
yqhV,spoIIIAA,spoIIIAB,spoIIIAC,spoIIIAD,spoIIIAE,spoIIIAF,spoIIIAG,spoIIIAH yqhV-spoIIIAABCDEFGH 2531540..2531581 -15.5 AAAAAGCCCGCUAAACAAGCGGGCUUUUUGCGUUGCUGU transcriptional fusions & Northern blotting (5.9 kb transcript) 1766372 (Illing & Errington, Mol. Microbiol. 1991, 5(8):1927-1940); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); Genbank U35252 Transcriptional fusions showed that spoIIIA contains at least the A, B, and C genes. Northern blotting revealed a yqhV-spoIIIAABCDEFGH transcript. The promoter in front of spoIIIAA may therefore be an internal promoter. BSORF lists a spoIIIAABCDEFGH transcript, in addition to shorter spoIIIAGH and spoIIIAH transcripts. Internal promoter in front of spoIIIAG, overlapping spoIIIAF.
yqhQ,yqhP yqhQP ND -11.3 UUUACCUAGCUCAAUCAGGGCUAGUUUUUUUUGUUGUGUU proposed 10482513 (Petersohn et al., J. Bacteriol. 1999, 181(18):5718-5724)
gcvT,gcvPA,gcvPB gcvT-gcvPA-gcvPB 2544602..2544641 -15.7 AAAAACAGCUGUCUACCAGACAGCUGUUUGCUUUAUUUCUU Northern blotting (4.2 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165) A potential readthrough terminator was found downstream of gcvPA (2.5 kb transcript). An internal promoter may exist upstream of gcvPA (2.8 kb transcript).
sinI,sinR sinIR 2552235..2552304 -25.3 AAAAAGAGGAGUAGUGCCUGAGCAGAGGCACUAACUCCUCUUUUGUCAAUAACCA S1 mapping of the 3' end 3125149 (Gaur et al., J. Bacteriol. 1988, 170(3):1046-1053) a second terminator structure CCAUCGAGACGGCCCAGUAUAUGAAUACUGGGCCGUCUCUUUUUUUUGCUGUUA with dG = -31.2 kcal/mole was found at 2552207..2552261; transcription ended at one of these two terminators. Termination sites are the first and last T in the T-stretch TCTTTTGT of the first terminator, and the first T in the T-stretch TCTCTTTTTTT of the second terminator. Internal promoter in front of sinR.
yqxM,sipW,tasA yqxM-sipW-tasA 2552197..2552251 -24.6 CAAAAGAGGAGUUAGUGCCUCUGCUCAGGCACUACUCCUCUUUUUGGGAUUUUCU lacZ transcriptional fusions; Northern blotting (2.5 kb transcript); upstream and downstream genes are on the opposite strand 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); 10464223 (Stover & Driks, J. Bacteriol. 1999, 181(17):5476-5481) internal promoters may exist. SubtiList proposes the terminator TTAATAACAGCAAAAAAAAGAGACGGCCCAGTATTCATATACTGGGCCGTCTCGATGGTTATTGACAAAAGAGG (dG = -32.6 kcal/mole) at position 2552243..2552316.
yqzG yqzG 2555068..2555114 -11.9 AAUAAGGUCCUCCAUUUUUUGAAGGACCUUAUUCGUUUAUUUG upstream and downstream genes are on the opposite strand ND
comGA,comGB,comGC,comGD,comGE,comGF,comGG,yqzE comGABCDEFG-yqzE 2554882..2554919 -16.1 GAACAGUACCUGUGCGAGCGGGUACCUUUUUUUUGCUUCUU S1 nuclease mapping; Northern blotting (5.0 kb transcript) 2507524 (Albano et al., J. Bacteriol. 171(10): 5386-5404, 1989); 2551886 (Albano et al., J. Bacteriol. 171(10): 5376-5385, 1989)
yqxL yqxL 2559476..2559512 -16.8 AUCUAGCAGGCAUGGUGACCAUGUCUGCUUUUUUAUUUAUAGG proposed 2507524 (Albano et al., J. Bacteriol. 171(10): 5386-5404, 1989)
yqhA yqhA 2562132..2562175 -19.5 UAGCAGCUGAACAGCCUUUCACGGGCUAUUCAGCUUUUUUAACUUCUAU ND ND
yqgZ yqgZ 2563210..2563266 -24.7 AAAAACCGAAGAUCCGCUGAUUUAUACGAAUCAGCUUAUCUUCGGUUUUUCACCUGUCCA ND ND
pstS,pstC,pstA,pstBA,pstBB pstSCABABB 2576410..2576457 -11.9 AAAAACAGGCUGAGUCAGCCUGUUUUUUUAUCGUGUU Northern blotting (4.4 kb transcript) 15289558 (Allenby et al., Microbiology 2004, 150(Pt.8):2619-2628) mRNA produced by this operon is rapidly degraded, except for pstS
yqfZ,yqfY yqfZY 2589464..2589516 -16.9 AAAAAGCUUGACGGGAACCCGUCAAGCUUUUUUGUGUUAGAA proposed 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)
yqfS,yqfU yqfSU 2591146..2591202 -15.7 GAAAAUGGCUUGCUGGACAGACAGCUGCCAUUUUCUUUUUCAUAC Northern blotting (2.3 kb transcript) 12486072 (Urtiz-Estrada et al., J. Bacteriol. 2003, 185(1):340-348) The gene yqfT is located between yqfS and yqfU, but is transcribed in the opposite direction.
yqxD,dnaG,sigA yqxD-dnaG-sigA 2599410..2599462 -18.4 AAGAUGGAACGGGUCUUGAAGAUCCGUUCUUCUUUUUUUAAAAAGAU subcloning into a terminator-probe plasmid 3086839 (Wang & Doi, Nucleic Acids Res. 1986, 14(10):4293-4307); 3298998 (Wang & Doi, Mol. Gen. Genet. 1987, 207(1):114-119) Internal promoters in front of dnaG and sigA. For the dnaG-sigA transcript, dnaG is transcribed but not translated.
antE antE 2602601..2602657 -4.5 CUUUAGUGCAAAAUCCCUUCAUCGUUCGACAGGAUUUUUUGCAGCAGUG transcription terminator probe vector 9864351 (Wang et al., J. Bacteriol. 1999, 181(1):353-356) The antE coding region overlaps the dnaG gene located on the opposite strand; the terminator is located between dnaG and yqxD. The stem-loop contains a sequence of three mismatched basepairs.
cdd cdd ND ND ND ND ND
yqfC,yqfD yqfCD ND ND ND proposed 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)
yqeZ,yqfA,yqfB yqeZ-yqfA-yqfB 2616184..2616250 -20.9 UAGAACCUCCUUUCAAAUCAUACACAUGAGAUGAAAGGGGGUUCUUUUUGUAUGGG proposed 11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457); SubtiList
hrcA,grpE,dnaK,dnaJ,yqeT,yqeU,yqeV hrcA-grpE-dnaKJ-yqeTUV 2620867..2620921 -13.2 AAAAAUCGGUGCAUUAAAAUGUACCGAUUUUUUUAUUUAGCC Northern blotting (8.0 kb transcript) 9023197 (Homuth et al., J. Bacteriol. 1997, 179(4):1153-1164); 11976317 (Condon et al., J. Bacteriol. 2002, 184(10):2845-2849); Genbank D83717; Genbank X52064 A readthrough terminator TCTGATTCAATGATTAGAAAGTCAAAGTCAGGCATCTCTTGGCTTTGACTTTTTTTCTTGCCCGGGATAAAAGGA exists downstream of dnaK at 2625203..2625277, leading to a 3.5 kb hrcA-grpE-dnaK transcript. An internal promoter upstream of dnaJ leads to a 4.3 kb dnaJ-yqeTUV transcript.
spoIIP,yqxA spoIIP-yqxA 2632047..2632089 -4.8 GAUAUGAUAGGGAACUUUUCUCUUUCUUGUUUUACAU proposed 7836306 (Frandsen & Stragier, J. Bacteriol. 1995, 177(3):716-722); Genbank D17650 Terminator sequence differs slightly from the sequence indicated in Genbank.
gpr gpr ND ND ND ND 1840582 (Sussman & Setlow, J. Bacteriol. 1991, 173(1):291-300); 7836306 (Frandsen & Stragier, J. Bacteriol. 1995, 177(3):716-722); Genbank D17650
comEA,comEB,comEC comEABC ND ND ND S1 nuclease mapping 7968523 (Hahn et al., Mol. Microbiol. 10(1): 99-111, 1993); SubtiList A minor promoter exists between comEA and comEB. The terminators proposed in the paper do not agree well with the S1 nuclease mapping result. A second termination site was found experimentally by Hahn et al. about 230 basepairs from the stop codon.
comER comER 2641300..2641346 -12.4 AAAAACCAUCGUUUUAGGAAACGAUGGUUUUUGAUUUCUGCG S1 nuclease mapping 7968523 (Hahn et al., Mol. Microbiol. 10(1): 99-111, 1993) S1 nuclease mapping showed that transcription ends near the indicated stem-loop.
cwlH cwlH 2648071..2648119 -16.5 ACGGAUAACCUGUUUCCAGUGCGGAUUCAGGUUAUUUUCUUUUCUUUGG Northern blotting (0.8 kb transcript) 10515909 (Nugroho et al., J. Bacteriol. 1999, 181(20):6230-6237) listed as yqeE in DBTBS
nucB nucB 2651562..2651625 -16.4 CAGUAGUAAAGAAGAGGCUCUUUCUUGAGCCUCUGUUGUUACAAUCCUUC proposed 7746143 (Van Sinderen et al., Mol. Microbiol. 1995, 15(2):213-223)
spoIVCB,spoIIIC spoIVCB-spoIIIC 2700967..2701021 -11.6 AAGAAGCCGGAUCUCAUACUCCGGCUUUCUCUAUUUGAAA upstream and downstream genes are in opposite directions 2536191 (Stragier et al., Science 1989, 243(4890):507-512); 3125151 (Errington et al., J. Bacteriol. 1988, 170(3):1162-1167) spoIVCB and spoIIIC form a composite gene in the mother cell during sporulation by excising the intervening DNA sequence.
spoIVCA spoIVCA 2652567..2652626 -11.8 AAAGAGGGGUGUAUGCACCCCCCUUUUGUAAUUACAAU proposed 2105293 (Sato et al., J. Bacteriol. 1990, 172(2):1092-1098)
arsR,yqcK,arsB,arsC arsR-yqcK-arsBC 2654499..2654535 -13.0 UUAAAGGAUGCAUAUUUAUAUGUGUCCUUUUUUUAUUAAUGU Northern blotting (2.4 kb transcript) 9537360 (Sato & Kobayashi, J. Bacteriol. 1998, 180(7):1655-1661)
rapE,phrE rapE-phrE 2659715..2659752 -8.9 CUUUAGCCGUUUCAUAACGGCUUUUUCUUAUUUCUA proposed 10629174 (Jiang et al., J. Bacteriol. 2000, 182(2):303-310); 11466295 (McQuade et al., J. Bacteriol. 2001, 183(16):4905-4909); Genbank Internal promoter in front of phrE.
blt,bltD blt-bltD ND ND ND Northern blotting (2.0 kb transcript) 7608059 (Ahmed et al., J. Bacteriol. 1995, 177(14):3904-3910)
azlB,azlC,azlD,brnQ,yrdK azlBCDbrnQyrdK 2726046..2726094 -8.9 AAAAAGCAAACUACAUACCGAAGUUUGCUUUUUUGCUCUAUAC lacZ transcriptional fusions; Northern blotting (3.5 kb transcript) 9287000 (Belitsky et al., J. Bacteriol. 1997, 179(17):5448-5457) This operon contains at least one internal promoter somewhere downstream from azlC (presumably in the 165 basepair gap between azlD and yrdK); Genbank U93876 shows another potential terminator in this gap.
levD,levE,levF,levG,sacC levDEFG-sacC 2757221..2757270 -17.4 AAAAAGGCACAGACCCGAACAGUCUGUGCCUUCUUGUUAUUUUAA 5' primer extension mapping of the sacC gene 2495266 (Martin et al., J. Bacteriol. 1989, 171(4):1885-1892); 3112519 (Martin et al., Mol. Gen. Genet. 1987, 208(1-2):177-184)
yrhI,yrhJ yrhIJ 2773078..2773120 -19.3 UAAAAUCCCGCCAAUCUGAUUGGCGGGAUUGCUUUGCAUAUGA proposed 10917605 (Palmer et al., Biochem. Soc. Trans. 1999, 27(4):374-378); Genbank U93874
yrhH yrhH 2777049..2777108 -15.7 GGAAAUAUAUCCAAGAUCCUCGUAUUAGGAUUUGGGUAUAUUUUCUUAAUUUUUU proposed 9636707 (Huang et al., J. Mol. Biol. 1998, 279(1):165-173); 9683469 (Huang et al., J. Bacteriol. 1998, 180(15):3765-3770); SubtiList
glnQ,glnH,glnM,glnP glnQHMP 2804532..2804575 -13.4 GAAAAGGAUACUCUUUGGAGAGUAUCCUUUUUGCAUUAAAAC Northern blotting (3.0 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); Genbank Z69371 A potential readthrough terminator TGAATAACAACCATCCCGGGATGAGCAGGCGATGCTCATCCCAATTTGATAAGGAGTGAATAGGCAGATGAATG was found downstream of glnH at position 2803150..2803223, leading to a 1.8 kb transcript.
yrvJ yrvJ 2819262..2819309 -12.0 AAAAAGCUGCCUUUUGGCAGCUUUUUUUAUUUUGAA proposed 9383190 (Wendrich & Marahiel, Mol. Microbiol. 1997, 26(1):65-79) bidirectional terminator
relA,yrvI relA-yrvI 2819272..2819315 -12.2 AAAAAGCUGCCAAAAGGCAGCUUUUUUUAUUGGAAG proposed 9383190 (Wendrich & Marahiel, Mol. Microbiol. 1997, 26(1):65-79) bidirectional terminator
yrvD yrvD ND ND ND proposed 15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107)
yrvE,apt yrvE-apt 2822070..2822117 -8.8 AAAAAGCACUCCAUGUCAGGGUGCUUUUUUCCUAUUGUU Northern blotting (3.0 kb transcript) 15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107) Internal promoter in front of apt, leading to a 0.6 kb transcript. Readthrough at this terminator leads to a 5.8 kb yrvE-apt-relA-yrvI transcript and a 3.3 kb apt-relA-yrvI transcript.
spoVB spoVB ND -8.1 CGAUAAUGGUCACGUGCGGUGCCCAUCUUUUUCAUCAAUAUA upstream and downstream genes are in opposite directions 1744050 (Popham & Stragier, J. Bacteriol. 1991, 173(24):7942-7949)
csbX,bofC csbX-bofC 2836097..2836132 -6.9 UUGAAGACAUGUAUUCAUGUCUUUUUUUUCGUGAAA insertional mutant and examination of bofC expression; plasmids and merodiploid 9099855 (Gomez & Cutting, Gene 1997, 188(1):29-33); 9025289 (Gomez & Cutting, Microbiology 1997, 143(Pt.1):157-170) internal promoter in front of bofC.
yrbD yrbD 2842284..2842335 -13.4 UAAAACCGGCCCGAUAUGACCUCGUGCCGGUUUUUUAUGAACGAU Northern blotting (1.5 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); SubtiList
safA,coxA safA-coxA 2843112..2843161 -19.5 GGAAGGGCUGCCGGAAGUGAUAUUCGGCAGCCUUUUUCUUUGCAUCA Northern blotting (2.0 kb transcript) 10438771 (Takamatsu et al., J. Bacteriol. 1999, 181(16):4986-4994) readthrough terminator downstream of safA, leading to a 1.2 kb safA monocistronic transcript; internal promoter in front of coxA leads to a 0.7 kb coxA monocistronic transcript.
nadB,nadC nadBC ND ND ND insertional plasmid 8444804 (Sun & Setlow, J. Bacteriol. 1993, 175(5):1423-1432)
nifS,yrxA nifS-yrxA 2850469..2850512 -7.6 AAAAAGCCCUCUAGUGGGCUUUUUUUAUAAUUGG proposed 8444804 (Sun & Setlow, J. Bacteriol. 1993, 175(5):1423-1432) bidirectional terminator
pheB,pheA pheBA 2850480..2850531 -7.8 AAAAAGCCCACUAGAGGGCUUUUUUUAGUCUUUA S1 protection 2537815 (Trach & Hoch, J. Bacteriol. 1989, 171(3):1362-1371); 8444804 (Sun & Setlow, J. Bacteriol. 1993, 175(5):1423-1432) Bidirectional terminator. S1 protection assay showed that pheB and pheA belong to the same operon, but did not fix the location of the terminator. Internal promoter in front of pheA.
spo0B,obg spo0B-obg 2851842..2851884 -20.5 UGAAAAGAGAGCCUGGUGCCAGGCUCUCUAUUUUAAAGGGGGGAU S1 protection 2537815 (Trach & Hoch, J. Bacteriol. 1989, 171(3):1362-1371) Readthrough, antitermination, or RNA processing may occur, leading to a spo0B-obg-pheBA transcript. The S1 protection assay showed that termination occurs at the indicated stem-loop.
rpmA rpmA 2854064..2854111 -14.8 AAAAACUCCGGUCGAUGAUGACUGGAGUUUUUUUUGCAAUAU proposed 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
spoIVFA,spoIVFB spoIVFAB 2855157..2855189 -9.1 CUAAAACUGAUUGACAAACGCCUUGUAUUUUGGUAUAUUUUUUAAUGUUAUG transcriptional fusions 1942049 (Cutting et al., J. Mol. Biol. 1991, 221(4):1237-1256) The transcriptional fusions show that the transcript does not extend more than 74 base pairs from the spoIVFB stop codon.
mreB,mreC,mreD,minC,minD mreBCD-minCD 2856942..2856998 -15.6 AAGAAUCUGACAAAGCAUAUGCUGUGUCAGGUUUUUUUUUGUUUUU integrative plasmids 1400225 (Varley & Stewart, J. Bacteriol. 1992, 174(21):6729-6742); 8459776 (Lee & Price, Mol. Microbiol. 1993, 7(4):601-610); 1942049 (Cutting et al., J. Mol. Biol. 1991, 221(4):1237-1256) Internal promoter in front of minC. The downstream gene spoIVFA most likely belongs to a different operon. However, this was not verified experimentally.
radC radC ND ND ND ND ND
comC comC 2863593..2863635 -11.9 UUUUUGGACAAGGCGACAAAAGUCUUGUUCUUUUUUUCUUUGCCU S1 nuclease mapping; Northern blotting (0.8 kb transcript) 1694528 (Mohan & Dubnau, J. Bacteriol. 1990, 172(7): 4064-4071); 2553669 (Mohan et al., J. Bacteriol. 1989, 171(11):6043-6051) S1 nuclease mapping showed that termination occurs near the center of the TTTTTTT stretch.
valS,folC valS-folC 2864491..2864534 -18.1 GGCUCCGGCAGAAUCAAAAAAAGAUUCUGCCGUUUUUUUCAUGUGUA Northern blotting (4.4 kb transcript) 9098041 (Luo et al., J. Bacteriol. 1997, 179(8):2472-2478); Genbank L04520 A readthrough terminator GTTAATGAAAAGCCGGGGCGGTTTCTAGAGAAACCGCCTTGTCTTATAAAAGAG was found at position 2865841..2865894 downstream of valS, leading to a 3.0 kb monocistronic valS transcript.
spoVID,ysxE spoVID-ysxE 2868567..2868614 -23.5 CGAAAGAGCUUUUCGUCCUUUUACAGGGAUGAAGAGCUCUUUUUUCGUUCUCAG transcriptional fusion of ysxE with lacZ; Northern blotting of the downstream valS gene 8449878 (Beall et al., J. Bacteriol. 1993, 175(6):1705-1716); 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078); 9098041 (Luo et al., J. Bacteriol. 1997, 179(8):2472-2478)
hemA,hemX,hemC,hemD,hemB,hemL hemAXCDBL 2871904..2871957 -15.8 GAAAACCGGUAUCAAGGACUCCUUGUGCCGGUUUUUUCGUGCUCUC genetic modification of hemL 1672867 (Hansson et al., J. Bacteriol. 1991, 173(8):2590-2599)
ysxD ysxD 2878922..2878966 -16.7 UAAAACCGGUAGAGGAUCCUCUACCGGUUUAUCAUUUUUUUG proposed 7961402 (Riethdorf et al., J. Bacteriol. 1994, 6518-6527) bidirectional terminator
lonA,ysxC lonA-ysxC 2878924..2878968 -16.7 AUAAACCGGUAGAGGAUCCUCUACCGGUUUUAUUUAUCGUAU proposed 7961402 (Riethdorf et al., J. Bacteriol. 1994, 6518-6527) bidirectional terminator
lonB lonB 2882009..2882046 -8.9 UUAAACCCUAUUUUGAUAAUAGGGUUUUUUUCAUGAAGG Northern blotting (1.7 kb transcript) 11325926 (Serrano et al., J. Bacteriol. 2001, 183(10):2995-3003); 7961402 (Riethdorf et al., J. Bacteriol. 1994, 176(21):6518-6527)
clpX clpX 2883800..2883850 -24.9 ACAAACCUCCUGAGUGGUAACACUCAGGAGGUUUUUUUGCAUGCAA Northern blotting (1.4 kb transcript) 8973311 (Gerth et al., Gene 1996, 181(1-2):77-83); 11325926 (Serrano et al., J. Bacteriol. 2001, 183(10):2995-3003); 10411757 (Liu et al., Mol. Microbiol. 1999, 33(2):415-428)
tig tig 2885323..2885370 -13.0 AACAGGGCGCGAAUCAUUCGUGCCUUGUUUUCGUACAAU proposed 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
ilvB,ilvH,ilvC,leuA,leuB,leuC,leuD ilvBHC-leuABCD 2887967..2888016 -13.5 AAAAAGCGGCCGGUAUUUGUCCGGCGGCUUUUUUUGCCUGGUG Northern blotting (8.5 kb transcript) 15060025 (Mader et al., J. Bacteriol. 2004, 186(8):2240-2252) RNA processing leads to a 5.8 kb ilvC-leuABCD transcript. A readthrough terminator CATCATTGAAGCGGGATTTCCCGCTTCGTCCCGAGGTGACTTTTTAGCTGTTCAGGA downstream of ilvC at 2892584..2892640 leads to a monocistronic 1.2 kb ilvC transcript.
ysnE ysnE 2897811..2897869 -18.1 AUAAGGAUAGAUAAGUGCAGGGGAAGGUCUGUCUUAUCUAUCUUUUUUUAUAUUCAC proposed 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
ysnF ysnF 2898822..2898876 -17.2 AAAAACCUCAAAUCCUAAAUGGAUUUGAGGUUUUUCUUUUGGUAC proposed; downstream genes are on the opposite strand 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
ysnB ysnB ND ND ND proposed 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078) The terminator proposed by Wipat et al. lacks a T-stretch.
gerM gerM 2901006..2901062 -10.7 AGAAAGAGGUUAGCGUUCCGGCUGCCUCUUUCUUUAUUCAAUU proposed 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
gerE gerE 2903747..2903795 -18.5 CCUUGCCGGUAUUCCUUCUUUUGGAAGGAGCCGGUUAUUGCUGUUUGUU integrational plasmids; Northern blotting (0.3 kb transcript) 3114423 (Cutting & Mandelstam, J. Gen. Microbiol. 1986, 132(Pt.11):3013-3024)
sdhC,sdhA,sdhB sdhCAB 2904601..2904649 -13.9 AAAAACCUCUUCCGCAUGGGAGAGGUUUUUUUAAACAAUA Northern blotting (3.45 kb transcript) 3027051 (Phillips et al., J. Bacteriol. 1987, 169(2):864-873); 3114423 (Cutting & Mandelstam, J. Gen. Microbiol. 1986, 132(Pt.11):3013-3024); 3036777 (Melin et al., J. Bacteriol. 1987, 169(7):3232-3236)
yslB yslB 2908530..2908584 -15.8 AAAAAGGCGGUGACUGCAUAGUCCCGCCUUUUUGAUUGUCAUU proposed 3036830 (Chen et al., J. Biol. Chem. 1987, 262(18):8787-8798) bidirectional terminator
lysC lysC 2908544..2908591 -15.7 AAAAAGGCGGGACUAUGCAGUCACCGCCUUUUUGAUUACACUG proposed 3036830 (Chen et al., J. Biol. Chem. 1987, 262(18):8787-8798) Bidirectional terminator.
trxA trxA 2912037..2912081 -14.0 CCAGAGCGAUUCCGAUUGAGGGAUCGCUUUUUUUAUUCGCCA Northern blot (0.6 kb transcript for the SigB promoter, 0.38 kb transcript for the SigA promoter) 9537387 (Scharf et al., J. Bacteriol. 1998, 180(7):1869-1877); 2559145 (Chen et al., J. Gen. Microbiol. 1989, 135(Pt.11):2931-2940)
xsa xsa 2912687..2912736 -20.7 CGCAAGAGCGCCGGAGCUUCAUGCCGGCGCUCUUUUUCAGGUUUUAA Northern blotting (1.6 kb transcript) 9537387 (Scharf et al., J. Bacteriol. 1998, 180(7):1869-1877); 14973026 (Raposo et al., J. Bacteriol. 2004, 186(5):1287-1296)
etfA etfA 2914396..2914444 -16.4 GAAAUCCCGGACUUUAAAAGUCCGGGUUUUUUCAUAUUUAU proposed 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078); 14973026 (Raposo et al., J. Bacteriol. 2004, 186(5):1287-1296)
lcfA lcfA ND ND ND ND ND
yshE yshE 2919454..2919506 -4.2 AAAAAGAAAGAUUUACCUUUCUUUUUCUUUUUUUUG proposed 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
yshB yshB 2924137..2924179 -10.3 AAAAACUUCUCUUGUCCGGAGAAGUUUUUUUCAAGUAUG proposed 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
rnhC rnhC 2926024..2926076 -16.1 AAAAAGCUUGCAGAUUUCUCUGCAAGCUUUUUUAUCAGCCUC proposed; upstream and downstream genes are on the opposite strand 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078) bidirectional terminator
pheT pheT 2926037..2926089 -18.8 AAAAAGCUUGCAGAGAAAUCUGCAAGCUUUUUUCUAUGAACG proposed; downstream gene is on the opposite strand 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078) bidirectional terminator
ysgA ysgA 2929586..2929635 -17.8 CACAACUCGUCCCUUGUACAAGGGACGGGUUUUUUUUAUUUUCC proposed 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
sspI sspI 2930977..2931012 -13.6 UGAAACCGGGUGACAGCGCCCGGUUUUUUUCUUAUAUA proposed 10806362 (Cabrera-Hernandez, Gene 2000, 248(1-2):169-181)
ysfD ysfD 2934980..2935031 -17.6 AGAAAGCCCAAAACAGACAUUGUUUUGGGCUUUUGUGCGUUAUUC proposed; downstream genes are on the opposite strand 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078) bidirectional terminator
ysfE ysfE 2934985..2935032 -17.6 CAAAAGCCCAAAACAAUGUCUGUUUUGGGCUUUCUCAUGAUGUUU proposed; downstream genes are on the opposite strand 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078) bidirectional terminator
araA,araB,araD,araL,araM,araN,araP,araQ,abfA araABDLMNPQ-abfA 2937356..2937412 -16.4 GCAAAGCCGGAGAUUUCUCUCCGGCUUGUCUUUCAACUGC Northern blotting (11.0 kb transcript) 9084180 (Sa-Nogueira et al., Microbiology 1997, 143(Pt.3):957-969); Genbank X89810 premature transcription termination or internal promoters may have lead to other detected mRNA lengths. One more putative terminator is listed in the Genbank record.
abnA abnA 2948095..2948135 -12.0 UGAAUAAAAAGCCGGGCUCUGCCCCCGGCUUUUUUUAAAAGAAA Northern blotting (0.9 kb transcript) 14973026 (Raposo et al., J. Bacteriol. 2004, 186(5):1287-1296); SubtiList
ysdB ysdB 2950921..2950975 -4.8 GAAGAGCGUUAAACGCUUUUCUGCUUUUUAU upstream and downstream genes are on the opposite strand 9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371); 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078) bidirectional terminator
ysdA ysdA 2950936..2950989 -17.7 AAAAAGCAGAAAAGCGUUUAACGCUCUUCUGCUUUUUUUGCGAGUUU proposed; downstream gene is on the opposite strand 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078) bidirectional terminator
rplT rplT 2951259..2951294 -16.5 AUAGAGCCGCUCUCCAGCAGAGCGGCUUUUUCUAUAUAAAG proposed 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
yscB yscB 2953484..2953539 -17.1 AAAAAGCCAAGGCAUUCAGCCUUGGCUUAUCCUCCGAUCAG Northern blotting (0.6 kb transcript) 15033535 (Serizawa et al., Gene 2004, 329:125-136) Bidirectional terminator. A 0.9 kb yscAB transcript was also detected.
ysbB ysbB 2953500..2953552 -16.9 GAUAAGCCAAGGCUGAAUGCCUUGGCUUUUUUUAUUUUAUG proposed 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078) bidirectional terminator
lytT lytT 2954806..2954852 -15.3 AAAAAGCUGCUCCAUAUUUGAUGGGCGGCUUUUUGCAUUUCAGC proposed 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
ysaA ysaA 2958245..2958297 -17.6 AAAAAGCAUGAUCUCUUCAAUGAGAUCAUGCUUUUUUAUUUUAUUU proposed; upstream and downstream genes are on the opposite strand 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078) bidirectional terminator
thrS thrS 2958252..2958314 -17.9 AAAAAGCAUGAUCUCAUUGAAGAGAUCAUGCUUUUUUUAUUUCUCU proposed; downstream gene is on the opposite strand 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078) bidirectional terminator
ytxC ytxC 2960251..2960291 -19.3 UUCAACCUCGUCCCUUUCAUAGGGGGCGGGGUUUUUAUAUGCAAAA proposed 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972); 8969504 (Wipat et al., Microbiology 1996, 142(Pt.11):3067-3078)
ytcG ytcG 2964686..2964728 -11.9 UAAAAGAGCUAAGAGGAUUCUUCUAGCUCUUUUCUCAUGUGCAA proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
gapB,speD gapB-speD 2965389..2965445 -30.1 CAAAGGGAGCUGAAGCUAGAAAGCCAUUAUGCGCUUUUUAGCUUAUGCUCCUUUUAUUUUUAUAAA Northern blotting (1.8 kb transcript) 10844697 (Sekowska et al., Mol. Microbiol. 2000, 36(5):1135-1147) internal promoter in front of speD leads to a 0.6 kb monocistronic speD transcript.
ytaG ytaG 2969925..2969971 -15.1 AAAAACACCGUUCAUAUUGAACGGUGUUUUUUGGCCAUUAA proposed; downstream genes are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
phoP,phoR phoPR 2974979..2975022 -16.3 UUGACGGCGGGAACCUAUUUGUGUUCCCGUCCUUUUUUGUGUCUUCU Northern blotting (2.7 kb transcript) 3142862 (Seki et al., J. Bacteriol. 1988, 170(12):5935-5938); 14762014 (Pragai et al., J. Bacteriol. 2004, 186(4):1182-1190)
citZ,icd,mdh citZ-icd-mdh 2977730..2977781 -4.8 AGAAAGGCUUGCUUAAUACAGCCUUUCUCUUUUUACUA proposed 8045898 (Jin & Sonenshein, J. Bacteriol. 1994, 176(15):4669-4679); 8550482 (Jin et al., J. Bacteriol. 1996, 178(2):560-563); 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220 internal promoters in front of icd and mdh
ytwI ytwI 2981610..2981661 -10.0 AAAAAGCGGCCUUAAAGCCGCUUUUUUUUAUGCAAA proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytvI ytvI 2983305..2983356 -19.5 UAAAACGGCAGCCGUUUUUUCAUGGCUGCCGUUUUUUAUUUGAUGA upstream and downstream genes are in the opposite direction 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972); SubtiList
pfkA,pyk,ytzA pfkA-pyk-ytzA 2983312..2983365 -18.2 AAAAACGGCAGCCAUGAAAAAACGGCUGCCGUUUUAUUUUUGCUGA Northern blotting (3.5 kb transcript) 11489127 (Ludwig et al., Mol. Microbiol. 2001, 41(2):409-422); Genbank AF008220; SubtiList A readthrough terminator CGAGCGTTCTTTAATTACAGGTGAAAATGGAAGGGGAATCCCTTCCTTTTCTCTTTATCATGCCTTTTGTTGA exists downstream of pyk at 2983768..2983840, leading to a 2.8 kb transcript.
accA accA 2986735..2986779 -11.4 AUAAACGUGAAGCCUUUGGCUCACGUUUAUUUUUUGUGAC proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytsJ ytsJ 2988801..2988876 -32.9 ACUGACGGCUGAAAUUUUUUUAGGGGGUUAGCCUUAAAAAAAUUUCAGCCGGGUUUAACAUUAUUUUU proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytrH,ytrI ytrHI ND ND ND 5' RACE-PCR of the downstream ytrI gene; gene downstream of ytrI is on the opposite strand 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972) ytrH gene was discovered by Eichenberger
ytqI ytqI 2994923..2994954 -16.9 UAAAGAACACGAGUAGAGGGGAGACCCUCUCUCUUAGUGUUCAUCUGU proposed; upstream and downstream gene are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220 bidirectional terminator
ytoI ytoI 2996275..2996320 ND ND proposed; downstream gene is on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220; SubtiList The terminator proposed in the Genbank record lacks a T-stretch.
ytmI,ytmJ,ytmK,ytmL,ytmM,ytmN,ytmO,ytnI,ytnJ,ribR,ytnL,ytnM ytmIJKLMNO-ytnIJ-ribR-ytnLM 2997735..2997764 -10.6 UGUAAGAAGCCGGUCGGGCUUCUUUUUUAUUUUCCAG Northern blotting (transcript length between 10 kb and 11 kb) 15272571 (Solovieva et al., Russian Journal of Genetics 2004, 40(5):580-583; Genetika 2004, 40(5):716-720); SubtiList
ytlI ytlI ND ND ND proposed; downstream gene is on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220; SubtiList The terminator listed in Genbank and SubtiList lacks a T-stretch
ytkL ytkL 3008907..3008967 -19.5 UGAAACCAUCUCCUGAUGAAUCAGGAGGUGGUUUUUAUUUUUUCAG proposed; upstream and downstream genes are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220; SubtiList bidirectional terminator
moaB moaB 3013503..3013555 -14.3 UGAAACUUCACCUGAAAUUUAGGUGAAGUUUUUUUUAUAAAAG proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220; SubtiList
ackA ackA 3014110..3014160 -12.5 UGAAAGCACAUUCUCUUGAAUGUGCUUUUUUGUUGAUGCA proposed 8226682 (Grundy et al., J. Bacteriol. 1993, 175(22):7348-7355)
ytxK ytxK ND -19.8 UAAAAGCAGCUUAGACAGCCGUAUGAGGUCGAUGCCUAAGCUGCUUUUAUUUAUGCUUU proposed 8226682 (Grundy et al., J. Bacteriol. 1993, 175(22):7348-7355)
tpx tpx 3016693..3016742 -14.6 AAAAAGCUCCAGGCUGCCGCCGGAGCUUUUUUCAUGGCAAG proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220; SubtiList
ytfJ ytfJ 3017309..3017361 -15.2 AAAAGGUUAACUGCGCUGGCCGCAGUUAACUUUUUUUUGGCAUAA proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
sppA,yteJ sppA-yteJ 3018536..3018568 -14.7 GAUAACCCGGACUUCCGUCCGGGUUUAUUUUUUUAGGA proposed Genbank AF008220; 9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371)
ytcJ ytcJ 3021076..3021117 -16.8 UAAAAGGACAGGCAGCAGCCUGUCCUUUUAUUUUCUAUAA proposed; downstream gene is on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
sspA sspA 3024426..3024464 -16.2 CUUAGGAGUGGGGGUAUCCCCACUCUUUUUCAUUUUUUAC Northern blotting (295 bp transcript) 3009398 (Connors et al., J. Bacteriol. 1986, 166(2):417-425)
braB braB 3028668..3028718 -18.7 CAGAACGCCUGCGUUAUUGCGCAGGCGUUUUGUAAUAAAAAA proposed; upstream and downstream gene are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ezrA ezrA 3028717..3028771 -11.7 AAAAAGAGCCCGCAGUGUAAUGAGCAGGCUCUUUUUUUAUUACAAA proposed; upstream and downstream gene are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
yttP yttP 3031375..3031409 -5.6 UCAGACCCAAACACAAGCGGGAUCUUCUUUUGCUUCGCU upstream and downstream gene are on the opposite strand ND
ytsP ytsP 3032698..3032744 -15.4 UAAAAGCCCAAAACUGAUAUCGUUUUGGGCUUUUUUUAUUUUAUU proposed; upstream and downstream gene are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytrP ytrP 3032699..3032756 -16.1 AAAAAGCCCAAAACGAUAUCAGUUUUGGGCUUUUAUAUUACUGCG proposed Genbank AF008220
rpsD rpsD 3035369..3035435 -17.3 AAAAACCCCUGCCGCUAUGCGGUCGGGGUUUUUUUAUCGGCUU Northern blotting (0.8 kb transcript) 1699930 (Grundy et al., J. Bacteriol. 1990, 172(11):6372-6379)
tyrS tyrS 3035602..3035660 -20.7 AAAAAGAUCCUUUGCCACUGAAGGCAAAGGAUCUUUUUGUUUACCGCA proposed 1735721 (Henkin et al., J. Bacteriol. 1992, 174(4):1299-1306)
acsA acsA 3036937..3036978 -22.5 UCAAUCGUCCCUUCGUGUAAACGAAGGGGCGUUUUUUAUUUUAAUU proposed 7934817 (Grundy et al., Mol. Microbiol. 10(2) 259-271, 1993)
acuA,acuB,acuC acuABC 3041577..3041634 -11.4 AAAAACGACCUUUACGAAGAGGUCGUUUUUGAUUUUUUAA proposed; downstream genes are on the opposite strand 7934817 (Grundy et al., Mol. Microbiol. 10(2) 259-271, 1993) bidirectional terminator
ytxE ytxE 3041591..3041637 -9.1 AAAAACGACCUCUUCGUAAAGGUCGUUUUUUACUUUGUUC proposed; downstream genes are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220 bidirectional terminator
aroA aroA 3044447..3044494 -12.7 CAAAAGGCCGCCGUGCGGCCUUUUUUUAUGCUUUC proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytxG,ytxH,ytxJ ytxGHJ 3045760..3045809 -13.6 AAAAAGCGUCCAGAUAUCAUCUGGCGCUUUUUUUUGUAAAAA plasmid integration 8733232 (Varon et al., Mol. Microbiol. 1996, 20(2):339-350)
murC murC 3047196..3047237 -9.6 AAAAAGCAGUGAUCUCACUGCUUUUUAUUUAUCUGA proposed 8733232 (Varon et al., Mol. Microbiol. 1996, 20(2):339-350) maybe readthrough
malS malS 3055858..3055909 -19.0 AAAGAGCCGCUGCAUAGGCAGCGGCUUCUAUUUUUUGCUU proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytmQ ytmQ 3058566..3058605 -14.2 AAAGACAGACUCUGACAGGAGUCUGUUUUUUUUAUGGGCC proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
amyX amyX 3060621..3060688 -18.4 UAAAGGACGGCUAUUGAUUAGCAUAUGAGACUCUCAAUAGCUGUCUUUUUUAUUUUUAUA proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytjP ytjP 3066434..3066478 -17.5 UAAAAGGACCGGCUUCUGCUGAAGCCAGUCCUUUUUUUAAAUAAAU proposed; upstream and downstream gene are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytiP ytiP 3069257..3069295 -12.4 AAAAACCCAAACGUCGCCGUUUGGGUUUUUUAUGUAAACA upstream and downstream genes are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220 bidirectional terminator
ythP,ythQ ythPQ 3069262..3069298 -16.0 AAAAACCCAAACGGCGACGUUUGGGUUUUUGGUCUAUCCU proposed 11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457); Genbank AF008220 bidirectional terminator
opuD opuD 3077388..3077445 -20.5 AAAAAGAUCUUUCCGCGCCUGCGGAAAGAUCUUUUUAUUUGCGAUA proposed; downstream genes are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220 bidirectional terminator
yteV yteV 3077402..3077446 -20.6 AAAAAGAUCUUUCCGCAGGCGCGGAAAGAUCUUUUUUGUUAAUAUG downstream genes are in the opposite direction 8990290 (Henriques et al., J. Bacteriol. 1997, 179(2):389-398) bidirectional terminator
ytcQ ytcQ 3084806..3084858 -7.9 CAAAACGCGCAAGCGGUUUUGGGUUUUUUAC proposed; downstream genes are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
bioW,bioA,bioF,bioD,bioB,bioI,ytbQ bioWAFDBI-ytbQ 3087407..3087462 -14.9 GAACGGAGCAUAAUCAUUUUCUAAGAUUAUGCUCUUUUUCUUUUGUUAU insertional mutagenesis; Northern blotting (7.0 kb transcript) 8763940 (Bower et al., J. Bacteriol. 1996, 178(14):4122-4130); Genbank AF008220 Readthrough terminator AAAGAATCAATAAAAGCAATCGGTATGATGTCGATTGTTTTTATTTTTG with dG = -17.8 kcal/mole at position 3089483..3089531 downstream of bioB, leading to a 5.0 kb bioWAFDB transcript
ytaP ytaP 3094661..3094712 -13.9 AAAAAGACCGUUUUGUGUGAAAACGGUCUUUUUGUUUCCUUUU proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
melA melA 3101224..3101269 -14.6 AAAAACUAGGGGACCGCUCUCCCCUAGUUUUUUGGUUUUGUU proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
leuS leuS 3101638..3101685 -14.2 AAAAAUCCCCUUUGCCAAAAGGGGAUUUUUUUUCAUCAGU proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
yttB yttB 3106221..3106303 -15.7 UAAAAGAUCCCGCCGAAUGAGCGGGAUCUUUCAGCGUGUCGAC proposed; upstream and downstream gene are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
yttA yttA 3108397..3108445 -14.9 AAAAAGCUCCAGAAUGUCUGGAGCUUUUUCUGUUUCACA Northern blotting (0.7 kb transcript); upstream and downstream genes are on the opposite strand 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220 bidirectional terminator
ytsD ytsD 3108408..3108451 -14.9 AAAAAGCUCCAGACAUUCUGGAGCUUUUUGUUUAUCGUU proposed; downstream gene is on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220 bidirectional terminator
ytrA,ytrB,ytrC,ytrD,ytrE,ytrF ytrABCDEF 3112991..3113044 -16.8 AACGAGCCGGCUGAGACAGCCGGCUUUUUCUAUAGCGCA Northern blotting (5.5 kb transcript) 10986249 (Yoshida et al., J. Bacteriol. 2000, 182(19):5454-5461); 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytpB ytpB 3120572..3120622 -12.7 AAAAAGCUCAAAUCAUUUGCUGAUCUGAGCUUUUUUUUCGAUGGC proposed; downstream genes are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143:3431-3441); Genbank AF008220
asnB,ytnA asnB-ytnA 3123267..3123311 -9.4 AAAAAGAGCUCCCAGUGGGCUCUUUUUGUGUGUGCUC Northern blotting (3.8 kb transcript) 10498721 (Yoshida et al., J. Bacteriol. 1999, 181(19):6081-6091); Genbank AF008220 The Northern blotting results did not give conclusive evidence that asnB and ytnA belong to the same operon. Genbank entry AF008220 also suggests the existence of a terminator between asnB and ytnA at position 3124721..3124778 (GTACGGAATATTCAGAAAAATGATATAATGATATTTTTTTCTAGGGGAGAAGAAGCAT)
metK metK 3126834..3126875 -14.3 UUAUAGCCGCUUACUGGUUAAGCGGCUUUCCCUUUUUUAUC proposed 9387221 (Lapidus et al., Microbiology 1997, 143:3431-3441); Genbank AF008220
pckA pckA 3130150..3130202 -19.4 CAAAAGCCAAGAGCAAUUAUGCUCUUGGCUUGUUUUAAUUGACG proposed; upstream and downstream genes are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143:3431-3441); Genbank AF008220 bidirectional terminator
ytmB ytmB 3130161..3130215 -19.3 AACAAGCCAAGAGCAUAAUUGCUCUUGGCUUUUGUUUUUUAUAC proposed; downstream gene is on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143:3431-3441); Genbank AF008220 bidirectional terminator
ytlD ytlD 3133973..3134035 -14.6 AAAAACCCGGCACAUGUGCCGGGUUUUUUAUUCAAUCC proposed 9387221 (Lapidus et al., Microbiology 1997, 143:3431-3441) bidirectional terminator
ytkD ytkD 3133999..3134046 -14.6 AAAAACCCGGCACAUGUGCCGGGUUUUUUAUGUCCUCC proposed 9387221 (Lapidus et al., Microbiology 1997, 143:3431-3441) bidirectional terminator
dps dps 3135234..3135290 -22.4 GAACGGCCGGAUGUCUUAAAAAAGACGUCCGGCUUUUCUUUUUGUAUC Northern blotting (0.5 kb transcript) 9393687 (Antelmann et al., J. Bacteriol. 1997, 179(23):7251-7256); 9387221 (Lapidus et al., Microbiology 1997, 143(11):3431-3441); SubtiList A 1.2 kb transcript was also detected, which may have been a ytkA-dps transcript. SubtiList shows an additional terminator TCTTAAAAAAGACGTCCGGCTTTTCTTTTTGTATCTG at position 3135225..3135261 (dG = -6.2 kcal/mole), which contains three consecutive mismatched bases.
luxS luxS 3136497..3136553 -18.8 GAAAGGACCUUUUUGCGCUUAAGCAAAAAGGUCUUUUUUGUGACGUCU roposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ythC ythC 3141086..3141144 -9.9 AGAAAGAGCUGCAUCAGCCAGCUCUUUCUUUUUGCAUGU proposed; downstream genes are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220 bidirectional terminator
mntA,mntB,mntC,mntD mntABCD 3141106..3141158 -9.6 AGAAAGAGCUGGCUGAUGCAGCUCUUUCUUUUAAUUAUA Northern blotting (4.0 kb transcript) 10760146 (Que & Helmann, Mol. Microbiol. 2000, 35(6):1454-1468); 15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107) bidirectional terminator
menF,menD,ytxM,menB,menE,menC menBEC 3145172..3145222 -13.4 UUGGACCGGCUGCUGACCCAGCCGGUUUUUUUAUGUAAAU proposed 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); 1629163 (Driscoll & Taber, J. Bacteriol. 1992, 174(15):5063-5071); 3131310 (Miller et al., J. Bacteriol. 1988, 170(6):2742-2748); Genbank AF008220 Readthrough terminator TCAGCAATATCTAGTAAACCAACAGCTTGAGACTTTGCGGTCCAAGCTGTTTTCTTTTCAATACAGACATTTT at position 3147876..3147948 was found by RNA protection assays downstream of menB. Internal promoter in front of menB and menE. An S1 nuclease experiment of the 5' end showed that menF and menD belong to the same operon. RNase protection assays showed that transcription of menB occurs from an upstream region in addition to the menB promoter, indicating that either no terminator or a readthrough terminator exists downstream of ytxM. Genbank AF008220 lists the terminator GCATGGTTAAGAAAAAAGCATTTTGCTATTTTGAATAAATGA (dG = -7.8 kcal/mole) at position 3145254..3145295 instead of the indicated terminator; SubtiList shows both.
yteA yteA 3153755..3153803 -12.9 UUGAACCCCCAAUUAUUGGGGGUUCUUUUCCGUUUUC proposed; upstream and downstream gene are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
cotSA,cotS,ytxO cotSA-cotS-ytxO 3158283..3158321 -11.2 CGCAAGGCAUAAAGUCACAUUUAUGCCUUUUUUUAAGUUCUC Northern blotting (2.7 kb transcript) 9603889 (Takamatsu et al., J. Bacteriol. 1998, 180(11):2968-2974); 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220
ytaB ytaB 3162749..3162787 -11.7 AAAAAGCCGCUUAUACAGCGGCUUUUUCACAUCAUCG proposed; downstream genes are on the opposite strand 9387221 (Lapidus et al., Microbiology 1997, 143(Pt.11):3431-3441); Genbank AF008220 bidirectional terminator
glgB,glgC,glgD,glgA,glgP glgBCDAP 3162751..3162797 -13.0 AAAAAGCCGCUGUAUAAGCGGCUUUUUUUGUUCACAG proposed 3162832 (Kiel et al., Mol. Microbiol. 1994, 11(1):203-218) bidirectional terminator
rrnB-16S,rrnB-23S,rrnB-5S,trnB-Val,trnB-Thr,trnB-Lys,trnB-Leu1,trnB-Gly1,trnB-Leu2,trnB-Arg,trnB-Pro,trnB-Ala,trnB-Met1,trnB-Met3,trnB-Ser1,trnB-Met2,trnB-Asp,trnB-Phe,trnB-His,trnB-Gly2,trnB-Ile2,trnB-Asn,trnB-Ser2,trnB-Glu rrnB-16S-rrnB-23S-rrnB-5S-trnB-Val-trnB-Thr-trnB-Lys-trnB-Leu1-trnB-Gly1-trnB-Leu2-trnB-Arg-trnB-Pro-trnB-Ala-trnB-Met1-trnB-Met3-trnB-Ser1-trnB-Met2-trnB-Asp-trnB-Phe-trnB-His-trnB-Gly2-trnB-Ile2-trnB-Asn-trnB-Ser2-trnB-Glu 3170887..3170926 -11.2 AGAAGCCUUGCAUAUCCUGCAAGGUUUUUUUGUUUUUAU proposed 2414156 (Green et al., Gene, 1985, 37(1-3):261-266) another putative terminator is TTTCTTCAGAAAATGAAGTTAATTGTCTATAAGTATAAGCGCTTTCAGGAAAGGGCTTTTTTTTATTTCTTCGAAT at 3170768..3170843
yuaF,yuaG,yuaI yuaFGI 3178923..3178976 -23.8 AAAAAUCCCCCAGCGGAAUUCGCUGGGGGAUUGUUACUUUUACGC proposed 9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371); SubtiList
yulF yulF 3196919..3196973 -21.0 AAAAAUCCGCCCGCGUGCAAAUGCCGCGGCGGAUUUUUUAUUAGACAA proposed; upstream and downstream genes are on the opposite strand 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93938
tlpB tlpB 3203065..3203122 -9.8 AGAAAGCGGCAUAUCUGCUGCUUUCUUUUUUUGUUA proposed 8188684 (Hanlon & Ordal, J. Biol. Chem. 1994, 269(19):14038-14046)
tlpA,mcpA tlpA-mcpA 3205166..3205214 -17.6 CUUAACACCCAAGCUUGUUGCGCUUGGGUGUUUUUUUUAGUUUUU proposed 8188684 (Hanlon & Ordal, J. Biol. Chem. 1994, 269(19):14038-14046) internal promoter suspected (but not shown experimentally) in front of mcpA
mcpB mcpB 3209445..3209490 -13.3 AAAAACAGCGCUAUCAAAGCGCUGUUUUUUUAUAUGGUA proposed 8188684 (Hanlon & Ordal, J. Biol. Chem. 1994, 269(19):14038-14046)
tgl tgl 3212358..3212425 -20.6 CAUCGUCCGCUAAAAAGCCCCAUCGCCUAUUUUCCGGACGAUGGGGUUUCAAAUGCCUUUCG proposed; upstream and downstream genes are on the opposite strand 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93935
yugT yugT 3213378..3213413 -9.1 CUAAACUCCAGCCUUAGACUGGAGUUUUUUUGUUUUAUC proposed 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93935
yugS yugS 3215163..3215214 -11.4 AAAAACAGCCGGGGAACAAACGGCUGUUUUUUGUGUCAUCA proposed 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93935
pgi,yugM,yugN pgi-yugMN 3218798..3218850 -15.0 UAAGAGGAGGGGAAAGCAUCGGCCCCUCCUUUUUUUGUAUGCCU Northern blotting (2.4 kb transcript) 11489127 (Ludwig et al., Mol. Microbiol. 2001, 41(2):409-422); Genbank Z93936 A readthrough terminator AAAAACGTCTGGAAGATTAATGTGAGAAAGCTGACTGGCATTTGCCGGTCGGCTTTTTATAAAATCAGAAA exists at position 3219718..3219788 downstream of pgi, leading to a 1.5 kb transcript. Genbank Z93936 lists another potential terminator ATGGCTGTTTACTTCTTAATTGAATGCGCTTTCTTTCCTGTTGGCCGCGCGAAAGAAACAACGATTTCCATGTAGGCGC at position 3219335..3219413 inside the yugM gene, and AAACAACGATTTCCATGTAGGCGCCTCTGAATGAAGTCTTGTTCGGCGGGACAGGATAAGTGAAAAA at position 3219292..3219358 downstream of yugM.
yugK yugK 3221191..3221244 -17.3 CCAAAGGGCGGAAUCCAGUCAUUCCGCCCUUUCUUCUUGACUUG proposed 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93934
yugJ yugJ 3222468..3222523 -17.2 AAAAGGGGAAAUAGCCGUUUGGCUGCUUCCCUUUUUCUUUUUUGUC proposed 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93934
yugI yugI 3224175..3224228 -20.4 AAAAAGCACCGGACAGGAAUGUUCGGUGCUUUUGAUUUCAUGCA proposed 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93934
yugF yugF 3227434..3227473 -9.4 AAAAACCGGUGCUGAACCGGUUUUUUUAAGGCGUG proposed; upstream and downstream gene are on the opposite strand 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93934 bidirectional terminator
yugE yugE 3227442..3227487 -8.1 AAAAACCGGUUCAGCACCGGUUUUUUUGUUAUUUG proposed; upstream and downstream gene are on the opposite strand 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93934 bidirectional terminator
patB patB 3228980..3229032 -15.1 GUAAACGCCUUUACGUCUUCAUUUGUAAAGGCGUUCUUAAUAAAGGAA proposed 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93933
kinB,kapB kinB-kapB 3230808..3230857 -13.0 CAUAACCCAGUCUGACAAAAGAUUGGGUUUUUUACGUCGCGC proposed 8497199 (Trach & Hoch, Mol. Microbiol. 1993, 8(1):69-79)
pbpD,yuxK pbpD-yuxK 3235295..3235346 -14.6 CAAAAUCCUAAAACGGCUUCGUUUUAGGAUUUUGUCAUCUAUUC proposed 7961491 (Popham & Setlow, J. Bacteriol. 1994, 176(23):7197-7205); Genbank Z93933
yufM yufM 3238483..3238541 -19.6 GAAAACGCACUGCUUGCUUUGAGCAGUGCGUUUUUCUGUCAUAUC proposed 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93937
yufN yufN 3240041..3240100 -16.9 AUCGCAGGGAUAAGGAGGUCGAGCCCUUAUCCCUUGUUUUUCUUUUAUUUU Northern blotting (1.4 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); SubtiList
maeN maeN 3245145..3245201 -15.8 AGAAAGAGUUCCGUUUUAUGCGGAACUCUUUUUUUAUUUAUUC Northern blotting (1.35 kb transcript); downstream genes are on the opposite strand 12949159 (Tanaka et al., Microbiology 2003, 149(Pt.9):2317-2329) synonym: yufR
mrpA,mrpB,mrpC,mrpD,mrpE,mrpF,mrpG mrpABCDEFG 3251403..3251454 -15.2 AUAAGCAGCCGGACAGGCAGAGUUCCGGCUGUUUUUUUAUUUCUUG Northern blotting (5.9 kb transcript); downstream genes are on the opposite strand 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); 10198001 (Ito et al., J. Bacteriol. 1999, 181(8):2394-2402); Genbank Z93932 bidirectional terminator
comA,yuxO comA-yuxO 3251407..3251455 -17.2 AAAAACAGCCGGAACUCUGCCUGUCCGGCUGCUUAUUUUUAUAAAUA S1 nuclease mapping 2507522 (Guillen et al., J. Bacteriol. 171(10), 5354-5361, 1989); 2507523 (Weinrauch et al., J. Bacteriol. 1989, 171(10):5362-5375) Bidirectional terminator. S1 nuclease mapping showed that termination occurs in the TTATTTT stretch.
comP comP 3252526..3252575 -15.4 GAAACGACUUGGCACAGGCCAAGUCUUUUUUAUAAAAUGG proposed 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93932
comQ,comX comQX 3254883..3254928 -7.0 AAUAACCCGUCAAUGGGGUGAUUAAUAGGUGGAUUA S1 nuclease mapping 1715859 (Weinrauch et al., J. Bacteriol. 173(18): 5686-5693, 1991) S1 nuclease mapping estimated that transcription ends about 30 base pairs downstream of the indicated stem-loop. As the stem-loop is not followed by a T-stretch, the mapped transcript end may actually be due to an RNA processing event. The indicated stem-loop overlaps the comX gene, which was unknown at that time. The downstream gene comP is separated by 14 base pairs from comX, suggesting that comP also belongs to this operon.
degQ degQ 3256104..3256147 -10.4 AAAAAGACUUGGAAACAAGUCUUUUUUUUCGUUCUA proposed 3007431 (Yang et al., J. Bacteriol. 166(1): 113-119, 1986)
yuzC yuzC ND ND ND upstream and downstream genes are in the opposite direction 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972); Genbank AF008220 The 3' ends of the yuzC and the converging yuxH coding regions overlap. A terminator for yuxH was found experimentally downstream of yuzC.
yuxH yuxH 3256633..3256685 -9.6 GAAAAGGCCACAACUUUAGCGUUGCGGUCUUUUUCGGUGUUUGU S1 nuclease mapping 2507522 (Guillen et al., J. Bacteriol. 171(10), 5354-5361, 1989); 2507523 (Weinrauch et al., J. Bacteriol. 171(10): 5362-5375, 1989) The 3' ends of the yuxH and the converging yuzC coding regions overlap. The terminator that was found experimentally for yuxH is downstream of yuzC, upstream of degQ. The low-resolution S1 nuclease mapping estimated the termination signal to be about 30 base pairs downstream of the indicated stem-loop.
yueK yueK 3258406..3258460 -19.5 AAAAACUGGCCUUUCAUUCGCGAAGGGCCAGUUUUCUUUAUGUAUA proposed 9274030 (Oudega et al., Microbiology 1997, 143(Pt.8):2769-2774); Genbank Z93932
yukF yukF ND ND ND ND 8226620 (Siranosian et al., J. Bacteriol. 175(21) 6789-6796, 1993) The putative terminator CGGCACATGGATTTGTGAAATTTCACAAATCCATGTTTTTTTATTTTCTT (dG = -21.2 kcal/mole) at position 3277234..3277263 is inside the yukF coding region.
ald ald 3278478..3278532 -14.8 AUAAGCUUGCAGAAAGAUUUCUGCAGGACUUUUUUAUUUUUUAA integrational mapping 8226620 (Siranosian et al., J. Bacteriol. 175(21) 6789-6796, 1993)
dhbA,dhbC,dhbE,dhbB,dhbF dhbACEBF 3279279..3279328 -15.4 AAAAAGAGACUGCUUGCCGCAGUCUCUUUUUCUAUCUUACG operon disruption 8921902 (Rowland et al., Gene 178(1-2):119-123, 1996) operon disruption showed that at least the first four genes belong to the same operon
yuiI yuiI 3291428..3291486 -16.4 ACUGAAAUUAUAUUUGACUGUCACAUGACAUUUGGAUAUGAUUAUUUUUAUAAUUGAUA proposed 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629)
guaC guaC 3303043..3303097 -20.9 AAAAACGCCAAGUCAGCGGUUCUCCGCUUGAGUUGGCGUUUUCUGCUACUUCU upstream and downstream genes are on the opposite strand Genbank Z93939
yunB yunB 3321456..3321514 -15.3 AAUAAGCCGCCUGUUGAAGAGGCGGCUUUUUGUUACUUCUU downstream gene is in the opposite direction 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972)
pucH pucH 3326239..3326287 -18.2 GUAAGCCCGGCGGAUUUUACCGCCGGGUUUUUUGAUUUCCUC proposed 12029039 (Beier et al., J. Bacteriol. 2002, 184(12):3232-3241); SubtiList
pucR,pucJ,pucK,pucL,pucM pucRJKLM 3334000..3334055 -17.4 AGGAAGCCCGCCUCACCGGCGGGCUUCUUUUUGCACUUC Northern blotting (6.2 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165) Internal promoter in front of pucJ, leading to a 4.6 kb transcript. Note that Beier (12029039) incorrectly assumed that pucR is transcribed monocistronically
pucA,pucB,pucC,pucD,pucE pucABCDE 3334762..3334803 -16.7 CGGGAGUCCGGCUUUUAAAAGCCGGACUUUUUUAGCCUCAGU Northern blotting (5.3 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
yurH,yurG yurHG 3340149..3340196 -15.4 GAAAAGCUUGCGGAACUCCGCAAGCUUUUUAACGAUAUGA proposed 12029039 (Beier et al., J. Bacteriol. 2002, 184(12):3232-3241); SubtiList Synonym: pucFG
yurR,yurQ,yurP,yurO,yurN,yurM,yurL yurRQPONML 3346061..3346111 -9.3 AAAAACGAGAAUACUAUAAGCAGUGUCUCGUUUUUUAUGCCUGUU Northern blotting (7.5 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165) The long mRNA molecule agrees poorly with the sequence and with the microarray data. The Northern blotting results also showed yurP (1.0 kb) and yurPO (2.5 kb) transcripts.
sspG,yurS sspG-yurS 3353507..3353549 -15.2 AAAAACCGCGGCCCCUCGGCCAGCGGUUUUUCUUCUGCAUA primer extension analysis of the downstream yurS gene; genes further downstream are on the opposite strand 9852018 (Bagyan et al., J. Bacteriol. 1998, 180(24):6704-6712); SubtiList
yusV yusV 3378081..3378146 -25.4 TAACGCAGCGAAGGAGCTTTCAATTGAGAAAGCTCCTTGCTGTTTTTTCGAAAGGAA proposed 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); SubtiList Terminator partially overlaps the downstream yusU gene.
mrgA mrgA 3383050..3383098 -17.0 AAAAAGCUGAACCUUAAUCGGGUUCAGCUUUUUGUUUUUUCUU downstream genes are on the opposite strand 8396117 (Chen et al., J. Bacteriol. 1993, 175(17):5428-5437); SubtiList
yvtA yvtA 3383052..3383104 -14.0 AAAAAGCUGAACCCGAUUAAGGUUCAGCUUUUUUGUUACCCUA upstream and downstream genes are on the opposite strand ND synonym for htrB
cssR,cssS cssRS 3386767..3386809 -14.0 CAAAAUAGACUGUAGAUGUUUUGCAGUCUAUUUUUUUAUGUGAAA proposed 11555295 (Hyyrylainen et al., Mol. Microbiol. 2001, 41(5):1159-1172)
citG citG 3388000..3388053 -16.9 AAGAACGGCUGCUUUUUAAGCAGCCGUUCUUCUAAAUAUGU upstream and downstream genes are in the opposite direction 3923430 (Miles & Guest, Nucleic Acids Res. 1985, 13(1):131-140)
gerAA,gerAB,gerAC gerAABC ND ND ND transcriptional fusions; upstream and downstream genes are in the opposite direction 3110007 (Zuberi et al., Gene 1987, 51(1):1-11)
yvrE yvrE 3404651..3404708 -15.1 AAAAACGCAUCCGAAACACGGAUGCGUUUUUUUAUACUACA ND ND
yvrP yvrP ND ND ND ND ND ND
fhuD fhuD 3418644..3418703 -14.8 CAAAAGAGCCGCCUGCCCGCGGCUCUUUUGCUUAUUUAUA ND ND
sspJ sspJ ND ND ND proposed 9852018 (Bagyan et al., J. Bacteriol. 1998, 180(24):6704-6712) The stem-loop identified by Bagyan et al. lacks a T-stretch.
yvgO yvgO 3427301..3427356 -14.3 AAAAAGCUGGCGCUCUAACGCCAGCUUUUUUUCUGCAUUU ND ND
yvgR,yvgQ yvgRQ 3429583..3429630 -18.1 GACGAGAGACAGGGAGUAGCUUCCUGUCUCUUUUUUCUAUAAUUU reverse transcription PCR 12169591 (Guillouard et al., J. Bacteriol. 2002, 184(17):4681-4689); SubtiList synonym: cysJI
bdbD,bdbC bdbDC 3436634..3436687 -16.4 AAAAAGCGCCCGCGUAUGCCGGGCGCUUUUUUAAUUUCGCA proposed 11744713 (Meima et al., J. Biol. Chem. 2002, 277(9):6994-7001)
opuBA,opuBB,opuBC,opuBD opuBABCD 3458797..3458836 -15.4 AAAAAGAGGCUGGAGUCCAGCCUCUUUUUUCUCUUUAAA proposed 10216873 (Kappes et al., Mol. Microbiol. 1999, 32(1):203-216)
cggR,gapA,pgk,tpiA,pgm,eno cggR-gapA-pgk-tpiA-pgm-eno 3475546..3475596 -19.1 AAAGACCGCCGGGAUUUUCUCUCGGCGGCUUUUUUAUGCUUUCA Northern blotting (7.4 kb transcript) 11489127 (Ludwig et al., Mol. Microbiol. 2001, 41(2):409-422); Genbank L29475; SubtiList A readthrough terminator AGCGCTATAATGAAAGCGGACAAGGGAAGGGGACGGACTCCCTTTCCCTTTTTCCATGAAGACCGGCTTTCAG was found at position 3480614..3480686 downstream of gapA, leading to a 2.2 kb cggR-gapA transcript and a 6.2 kb gapA-pgk-tpiA-pgm-eno transcript. Internal promoters in front of gapA and pgk, leading to a 1.2 kb monocistronic gapA transcript and a 4.8 kb pgk-tpiA-pgm-eno transcript.
araE araE 3483056..3483103 -19.8 UGAAACAGCCCUUUCUACGGGAAGGGCUGUUUAUAUUGGGAUGC Northern blotting (1.7 kb transcript) 9401028 (Sa-Nogueira & Ramos, J. Bacteriol. 1997, 179(24):7705-7711); Genbank Y12105
araR araR 3485773..3485830 -15.7 AAAAAGCAAUGUAUGGGUCUCCCCGCUACAUUGCUUUUUUUAUAGCUGU Northern blotting (1.4 kb transcript) 9045819 (Sa-Nogueira & Mota, J. Bacteriol. 1997, 179(5):1598-1608); Genbank X98354
yvfK,yvfL,yvfM,lacA,yvfO yvfKLM-lacA-yvfO 3500628..3500691 -27.2 AAAAAAUCCAUGAGAUGUAACAAAUCAUUGUUAUGUCUCAUGGAUCAUUUUAUUUUACAUCA proposed 9287030 (Daniel et al., J. Bacteriol. 1997, 179(17):5636-5638)
yvfG yvfG 3513126..3513176 -18.0 AUAAACCUUCCGCUCACAUGUGAGCAGGAAGGUUUUCCUUCUUUGAG Northern blotting (0.24 kb transcript) 15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107); Genbank Z71928
yveK,yveL yveKL ND ND ND Northern blotting (1.2 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
pbpE,racX pbpE-racX 3532407..3532462 -17.0 UCAGACAAGGACUGUCUUCAAACAGUCCUUGUUUUUUUAUGUUCCU mutational analysis 8491712 (Popham & Setlow, J. Bacteriol. 1993, 175(10):2917-2925)
sacB,yveB,yveA sacB-yveBA 3539741..3539791 -14.8 AUAAAGAAGCAAGAGGUUUUCUUGCUUCUUUAUUCUUUACAAA Northern blotting (4.9 kb transcript) 11739774 (Pereira et al., Microbiology 2001, 147(Pt.12):3413-3419) the readthrough terminators AAACGCAAAAGAAAATGCCGATATCCTATTGGCATTTTCTTTTATTTCTTATC at 3536464..3536516 and TGAATAAAAACAGGGGCGGCGCAGGCTGCCCCTGTTTTTTTATTAGGAGC at 3538081..3538130 were found downstream of sacB and yveB respectively, leading to a 1.7 kb monocistronic sacB transcript and a 3.3 kb sacB-yveB transcript.
clpP clpP 3545855..3545903 -17.7 CACAACCUGCAAGAGCUGCGUCUCUUGCAGGUUUUUUUCAUUUCAA Northern blotting (0.8 kb transcript) 8973311 (Gerth et al., Gene 1996, 181(1-2):77-83); 9643546 (Gerth et al., Mol. Microbiol. 1998, 28(4):787-802) mRNA length not quite consistent with terminator position
yvlA,yvlB,yvlC,yvlD yvlABCD 3605759..3605811 -11.9 AAAAAGCUGCCCGCAAAGGCAGCUUUUUUACAUGUGGU proposed 9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371); Sonenshein
yvzB yvzB 3608368..3608425 -24.2 UUACAGCUUGCCGACAGAGUCCAUUAACUGGAUGUGCCGGCAGGCUUUUUUUGUUACAAU Northern blotting (approximately 1.0 kb transcript) 15033535 (Serizawa et al., Gene 2004, 329:125-136)
uvrB,uvrA uvrBA 3609030..3609084 -23.2 GGACAGCUUGUCGGCAAGUCCAUCCUUGGGCUUAGCAGGCAAGCUUUUUCUUUACGGCA proposed SubtiList
csbA csbA 3614083..3614137 -14.9 GAAUACCUGCUUUUACGUUUUAAAAGCAGGUUUUUUAUACACAAA terminator-probe plasmids 1744042 (Boylan et al., J. Bacteriol. 1991, 173(24):7856-7866)
yvyD yvyD 3629990..3630052 -15.7 AGAAGCCUUCCGUGAUGUCCGCGGAAGGUUUUUGUUUUUCUUA Northern blotting (0.6 kb transcript) 9852014 (Drzewiecki et al., J. Bacteriol. 1998, 180(24):6674-6680); 8195064 (Chen & Helmann, J. Bacteriol. 1994, 176(11):3093-3101)
yvyC,fliD,fliS,fliT yvyC-fliDST 3631015..3631057 -21.5 AACAGAAGGGGAUCGGAUCUACCAAGAUCUGAUCCAAGCCUUUUUUUAUUUGGAUUC proposed 8195064 (Chen & Helmann, J. Bacteriol. 1994, 176(11):3093-3101)
hag hag 3633977..3634018 -16.9 AAAAAGACCUUGGCGUUGCCAGGGUCUUUUAAUUUAAAUUU Northern blotting (1.0 kb transcript) 2498284 (Mirel & Chamberlin, J. Bacteriol. 1989, 171(6):3095-3101)
csrA csrA 3635061..3635106 -12.4 CAUUAUCCUCACAAAAAAAGUGAGGAUUUUUUUAUUUUUGU proposed 8969505 (Soldo et al., Microbiology 1996, 142(Pt.11):3079-3088); Genbank U56901
yvyF,flgM,yvyG,flgK,flgL yvyF-flgM-yvyG-flgKL 3636340..3636389 -8.1 AGUAAGCGGCUCUUAGGAGUUCGCUUUUUUUAUAGUUCA proposed 8969505 (Soldo et al., Microbiology 1996, 142(Pt.11):3079-3088); 8045879 (Mirel et al., J. Bacteriol. 1994, 176(15):4492-4500) Soldo et al. suggest that the stem-loop structure may be an mRNA stabilizer rather than a terminator. In that case, the operon would also contain the genes yviE, yviF, and csrA. Serizawa et al. (Gene, 329:125-136, 2004) show that yviE-yviF, like the yvyF operon, are SigD-dependent.
comFA,comFB,comFC comFABC 3640139..3640166 -4.6 UUGAUCAGAAGCUAAAUGAUUCUGUUUUUAUGCCGAUAU proposed 8412657 (Londono-Vallejo et al., Mol. Microbiol. 9(1): 119-131, 1993)
yviA yviA 3642654..3642706 -13.5 CCAAAUCUCCGUUUUUAGAGCGGAGAUUUUUUUAUAUUCUU proposed 8412657 (Londono-Vallejo et al., Mol. Microbiol. 9(1): 119-131, 1993)
degS,degU degSU 3643596..3643644 -15.5 UAGGAGACUUGCCUUUUACUAGGCAGGUCUUUUUUUAGGCUGCC lacZ fusions 1688843 (Msadek et al., J. Bacteriol. 172(2): 824-834, 1990); 8969505 (Soldo et al., Microbiology 1996, 142(Pt.11):3079-3088); Genbank U56901 The terminator downstream of degU suggests that the downstream yviA gene does not belong to this operon.
yvhJ yvhJ 3647601..3647666 -22.9 AAAAAUGCCCGGUCCUUUUAGAGGAUCGGGCAUUUUUGCGCAGAAAA proposed; downstream genes are on the opposite strand 8969505 (Soldo et al., Microbiology 1996, 142(Pt.11):3079-3088); Genbank U56901 SubtiList also shows the terminator GCGCAGAAAAAAACTCCGGCACATAAGCCGGAGTTTTTAATTCCTTTTCACCAGCCGTTTATA (dG = -22.5 kcal/mole) at position 3647648..3647710.
tuaA,tuaB,tuaC,tuaD,tuaE,tuaF,tuaG,tuaH tuaABCDEFGH 3648878..3648934 -14.6 AACAUGCGUAGUCCUAUAAAUUGGGAUGCGCGUUUUUUGAUUAUACG Northern blotting (9.0 kb transcript); transcriptional fusions to tuaD and tuaH 10627039 (Lahooti & Harwood, Microbiology 1999, 145(Pt.12):3409-3417); 10048024 (Soldo et al., Mol. Microbiol. 1999, 31(3):795-805); Genbank AF015609 several smaller mRNA molecules were also detected; these may be prematurely terminated transcripts or processed products.
lytA,lytB,lytC lytABC 3658110..3658159 -16.7 CGAAAGAGACAAAUCUAAUCACAGAUUUGUCUCUUUUUUAUAUGAAAU Northern blotting (4.1 kb transcript) 1357079 (Lazarevic et al., J. Gen. Microbiol. 1992, 138(Pt.9):1949-1961); 8093697 (Kuroda & Sekiguchi, J. Bacteriol. 1993, 175(3):795-801) Shorter transcripts were also detected.
lytR lytR 3663219..3663275 -16.6 AAAAAGAAGCUUCGCACAAUGUGCAAAGCUUCUUUUUUAUUUGCCUG proposed 1357079 (Lazarevic et al., J. Gen. Microbiol. 1992, 138(Pt.9):1949-1961)
gtaB gtaB 3665527..3665581 -17.2 AAAAAGGCUAUUGGACAUUCAUCCAAUAGCCUUUUUUUAUUUCAAC proposed 8320212 (Varon et al., J. Bacteriol. 1993, 175(13):3964-3971)
tagD,tagE,tagF tagDEF 3675135..3675166 -15.0 UGUAUAGCUGUCGAUUUUUCGGCAGCUUUUUAGAUACUUGUU proposed 2507871 (Honeyman & Stewart, Mol. Microbiol. 1989, 3(9):1257-1268) Honeyman & Stewart propose that the ATTTTATAAAAT inverted repeat in front of the terminator hairpin functions to slow the RNA polymerase prior to transcription termination. See also 94251 (Rosenberg & Court, Annu. Rev. Genet. 1979, 13:319-353).
tagA,tagB tagAB 3682337..3682388 -17.5 AUGAUGACACUUGUUCAAAACAGAACAAGUGUUCUUUUUUCUAUUGAAU proposed 7952180 (Mauel et al., Microbiology 1994, 140(Pt.9):2279-2288); SubtiList integrational plasmids showed that tagC does not belong to the proposed tabAB operon
tagC tagC 3683794..3683846 -24.7 UCAAAUAGGCUGUAGCUAUUUAAUAGCUACAGCCUAUUUGCAACUUUCUAA proposed 7934877 (Margot et al., Mol. Microbiol. 1994, 12(4):535-545) bidirectional terminator
lytD lytD 3683798..3683851 -24.7 GCAAAUAGGCUGUAGCUAUUAAAUAGCUACAGCCUAUUUGAUUAUCACACC proposed 7934877 (Margot et al., Mol. Microbiol. 1994, 12(4):535-545) bidirectional terminator
pmi pmi 3686596..3686640 -11.5 UUAAACUUAAUCUCACUUCGAGGUUAAGUUUUUUUAUUAGAAA proposed 7934877 (Margot et al., Mol. Microbiol. 1994, 12(4):535-545)
gerBA,gerBB,gerBC gerBABC 3691525..3691566 -19.0 CAAAAGGGUGCGCAUGAUCGCGCACCCUUUUUUAUGUUCCGA transcriptional integrations; upstream and downstream genes are transcribed in the opposite direction 8012571 (Corfe et al., Microbiology 1994, 140(Pt.3):471-478); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92954 bidirectional terminator
ywtG ywtG 3691522..3691563 -18.9 AAAAAGGGUGCGCGAUCAUGCGCACCCUUUUGAUUGCUUACU proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92954 bidirectional terminator
ywtF ywtF 3694230..3694278 -21.1 AUGAACGGGAUGGCGAUUACGCCAUCCCGUUUUACAUAUUUCCU proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92954
ywtD ywtD 3695250..3695298 -12.4 AAAAAGACUCCAAUCUCUGGAGUCUUUUCUUUAUGCAUA proposed 15033535 (Serizawa et al., Gene 2004, 329:125-136); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92954
ywsC,ywtA,ywtB,ywtC ywsC-ywtABC 3696624..3696682 -18.0 AAAAAGAGAGUGUCUGAUGAGACACUCUCUUUUUAUUUGCCCAG Northern blotting (3.0 kb transcript) 11751809 (Urushibata et al., J. Bacteriol. 2002, 184(2):337-343); Genbank Z92954
rbsR,rbsK,rbsD,rbsA,rbsC,rbsB rbsRKDACB ND ND ND proposed 7921236 (Woodson & Devine, Microbiology, 1994, 140(Pt.8):1829-1838)
ywsB ywsB 3706689..3706746 -22.1 UGAGAGGGAUUCCGCAUAAAUGCGGAAUCCCUUUUAUUAUGAAUUG proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92953
ywrO ywrO 3707158..3707210 -23.4 UAAAAUACAGCCCUGUCCAACAUACGGCAGGGCUGUAUUUGUUUAAAAAUCC proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z93767
alsS,alsD alsSD 3707776..3707827 -6.8 AGAAAGCCCCTTTTAGCAGGGCTTTCTTTTTATTTGG proposed 7685336 (Renna et al., J. Bacteriol. 175(12), 3863-3875, 1993)
ywrJ ywrJ 3712983..3713039 -11.9 CAAAACUGCCCUCUUGAAAAGCAGAAGGCAGUUUUUCGUUUCAUAC proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z93767
cotB cotB 3713721..3713762 -11.4 AUGGAGGAGCAUCAGAUAAAGUGAUGCCCUUUUUCAGUUAAAGG proposed Sonenshein Genbank Z93767 does not list a terminator for cotB. Predicted terminators in Genbank Z93767 suggest a cotHB-ywrJ operon.
cotH cotH ND ND ND proposed 8755863 (Naclerio et al., J. Bacteriol. 1996, 178(15):4375-4380) Sonenshein lists cotH as monocistronic. Predicted terminators in Genbank Z93767 suggest a cotHB-ywrJ operon.
cotG cotG 3716850..3716913 -14.8 UUCAAUAGGCUGCCGGCGGAGGUACGGAAGCCUAUUUUUUUAUUUGCCC proposed 7814326 (Sacco et al., J. Bacteriol. 1995, 177(2):372-377)
ywrE ywrE ND ND ND downstream genes are on the opposite strand 9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371)
ywrD ywrD 3717730..3717781 -19.5 UAAAAGAACACCCCGAGCUUGCUCUGGGUGUUCUUUUUUUUGAUAUUU Northern blotting (2.0 kb transcript); upstream and downstream genes are on the opposite strand 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165) This terminator is located after the downstream gene ywrE, which is transcribed in the opposite direction.
ywqO ywqO 3721567..3721613 -10.2 AAAAAGCACCUGUCCAGGUGCUUUUUUCUAUAAAUA proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92952
ywqL ywqL 3723414..3723461 -12.4 UGUAACACUUGGGGCUCUAAGUCAUCAAGUGUUUUUUUUGUAUGUG proposed; downstream gene is on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92952
ywqF ywqF 3728477..3728519 -10.3 AGAAAGGCUGGUUGCGCACCAGUCUUUUUUUCAUCUAUU proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z92952
ywqA ywqA 3737231..3737290 -17.9 AAAAAGCUGGCUCUAAAAGAGCCAGCUUUUUUCCGUUCAUA proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z83337
ywpH,glcR ywpH-glcR ND ND ND Northern blotting (1.4 kb transcript) 14762004 (Lindner et al., J. Bacteriol. 2004, 186(4):1097-1105) A longer transcript of 2.4 kb was assumed to be due to readthrough into the downstream ywpJ gene.
ywpE ywpE 3740699..3740746 -17.0 GAAAAGCUGCCGUUCAAAACGGCAGCUUUUUUCAUGCAGAA proposed; upstream and downstream gene are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z83337
mscL mscL 3742257..3742309 -14.2 AAAAAGAUGCCGUUAGAAACGGCGUCUUUUUUUAUCUCAAU proposed; downstream gene is on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z83337
rapD rapD 3744728..3744780 -12.1 AAGCCGCUUUUUUUAUCAUGCGCGGCUGAUUGAAAAACGCCCAUUUUCUUAUUAUCUG proposed; upstream and downstream genes are on the opposite strand 9636707 (Huang & Helmann, J. Mol. Biol. 1998, 279(1):165-173)
mbl,flhO,flhP mbl-flhOP 3744202..3744239 -23.7 AAAAUGGGCGUUUUUCAAUCAGCCGCGCAUGAUAAAAAAAGCGGCUUUUUCGAAAUCGUCCUUUUUUUUGUAGUAU Northern blotting (2.8 kb transcript) 15033535 (Serizawa et al., Gene 2004, 329:125-136); 7836311 (Abhayawardhane & Stewart, J. Bacteriol. 1995, 177(3):765-773) A readthrough terminator AGCTGATTTCACAAACCTCATTCTGAAAAAGAATGAGGTTTTTTTATGAAAAAGCCTTCACGAA was found downstream of mbl at position 3746248..3746311, leading to a 1.0 kb transcript. The Northern blotting results suggest the existence of an internal promoter in front of flhO, leading to a 1.8 kb transcript.
usd,spoIIID,mbl usd-spoIIID-mbl 3746235..3746277 -15.1 ACAAACCUCAUUCUGAAAAAGAAUGAGGUUUUUUUAUGAAAAA transcriptional fusions; Northern blotting (1.34 kb transcript) 1469717 (Halberg & Kroos, J. Mol. Biol. 1992, 228(3):840-849); 9023218 (Decatur et al., J. Bacteriol. 1997, 179(4):1324-1328); 7836311 (Abhayawardhane & Stewart, J. Bacteriol. 1995, 177(3):765-773) Note that Stevens & Errington (2112673, Mol. Microbiol. 1990, 4(4):543-551) proposed a different terminator between spoIIID and mbl. The mRNA transcript extends 830 basepairs beyond the spoIIID coding region, which is too short to cover mbl completely. A mbl-specific vegetative promoter may exist inside the spoIIID coding region (Sonenshein page 495).
ywoG ywoG 3749695..3749741 -22.2 UGUCAGACUGCCGGGAAAUCCCGGCAGUCUUUUUUCCAUUAAAA proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z82987
ywoF ywoF 3749739..3749792 -27.9 UAUAAGCGGCGUUCUCUCGUUCAACCGAGAGGGCGCCGUGUUUUAAUGGAAAAAA proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z82987
ywoE ywoE ND -11.0 GGUCCGCCAGGCUGAAUAAGAUCUAUUUAGACGGUAUAUUUUCAUAUUUUUGA proposed 12029039 (Beier et al., J. Bacteriol. 2002, 184(12):3232-3241) Synonym: pucI.
ywoD ywoD 3752915..3752962 -16.2 AGAAAGAGACGGGCUCUGAGGUCUGUCUCUUUUUCUUGUUUAAG proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z82987
nrgA,nrgB nrgAB 3757383..3757427 -15.8 GGUACGAGAUUCGGACACUCCGGAUCUCUUUUUUUGUGCACAG primer extension analysis of nrgA and nrgB transcripts; Northern blotting (1.6 kb transcript) 8282685 (Wray et al., J. Bacteriol. 1994, 176(1):108-114); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
ywoA ywoA 3758152..3758200 -19.3 CAAAAGCCGGCGUCUGAAAUCAAGACAGCCGGCUUUAAUAUUUCUCAU proposed 12399481 (Cao & Helmann, J. Bacteriol. 2002, 184(22):6123-6129); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328) bidirectional terminator
ywnJ ywnJ 3758154..3758199 -19.5 UUAAAGCCGGCUGUCUUGAUUUCAGACGCCGGCUUUUGUCUUUCUUAG proposed 12399481 (Cao & Helmann, J. Bacteriol. 2002, 184(22):6123-6129); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328) bidirectional terminator
spoIIQ spoIIQ 3758682..3758734 -10.6 GAAAACGUCUAUCCUUGUGAUGGGCGUUUUUUUCUGUUACU proposed 9140963 (Londono-Vallejo et al., Mol. Microbiol. 1997, 24(1):29-39); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Y08559
ywnF ywnF 3760956..3761006 -28.4 GAUCUGCACCCGGAUUGUUGAGAUUUUCCAGACGAUCCGGGUGUGUUUUUUUGCAUGCAG proposed; upstream and downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Y08559
mta mta 3763131..3763172 -24.3 GAAAACCCCCGGCCGUAAAGGCCGGGGGUUUACGCAUCUUAUA upstream and downstream gene are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Y08559
ywnB ywnB 3764459..3764503 -13.2 AAAAACCCGGAGCCAGCUCCGGGUUUUUCUCAUUAAUA proposed; downstream gene is on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Y08559
ureA,ureB,ureC ureABC 3765701..3765744 -18.3 AGACGCGGCCGGAGUGCAUCCGGCCGUUCUAUUGACUAAAA Northern blotting (2.6 kb transcript) 9150240 (Cruz-Ramos et al., J. Bacteriol. 1997, 179(10):3371-3373); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
ywmF,csbD ywmF-csbD 3769081..3769131 -14.6 GAAGAGGCAGGAAACGAAAUGUUUCUUGUCUUUUUUUUUCGCUUU proposed 9287005 (Wray et al., J. Bacteriol. 1997, 179(17):5494-5501); 10376822 (Akbar et al., Microbiology 1999, 145(Pt.5):1069-1078) internal promoter in front of csbD
rapB rapB 3769989..3770035 -9.9 CAAAACCAUCUGCUGGCAGAUGGUUUUUUUUUAUGCAA proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
moaA moaA 3771302..3771354 -12.8 CAAAAGCUUAUCGGCACUGUCCGGUAAGCUUUUUUAUUAGAAUC proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z81356
ywmE ywmE 3773249..3773289 -12.8 GUAAAAGCCCUUUAUAUAGAGGGCUCUUUUUGUGUCUCAGA ND ND
ywmD ywmD 3773631..3773684 -12.2 GAUCAGGCGCUCCCCCAGGCGCCUUUUUUAUUGGUUUA proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z81356
ywmC ywmC 3774638..3774677 -14.0 AAAAAGAGGCUGGUGAUGGUCAGCCUCUUUUUGUAUGUAACA proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z81356
spoIID spoIID 3775714..3775769 -11.4 AAAAAGACGCUCAUUGGGCGUCUUUUUCUGUUCCUGA integrational plasmids 3011962 (Lopez-Diaz et al., J. Gen. Microbiol. 1986, 132(Pt.2):341-354)
murAA murAA 3776915..3776987 -15.0 GAAAAUCAGUAUGUCACUCUGGCAUACUGGUUUUUUAUUUUUUGU proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z81356
atpC atpC 3780055..3780111 -14.0 AAAAAUCCUUCUCUUUAUGAGAAGGAUUUUUUUAUGAACGC proposed; downstream gene is on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
upp upp 3787414..3787461 -8.6 UGAAAUCCCCAAAAGGGGGUUUCAUUUUUUUAUC proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z38002
glyA glyA 3788172..3788220 -20.0 UAAAACCCGCUUGGGCUUAUGCCCGGCGGGUUUUUUGACGAUGUU proposed Genbank Z38002 no terminator identified in Genbank L47648
ywlF,ywlG ywlFG 3789634..3789686 -5.6 GAAAGGACUGCAUAGCCAGUCUUUUCUUUUAUUUUA Northern blotting (1.1 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z38002
ywlB ywlB 3793115..3793182 -20.6 UAUUAGCGUUGUCCACAAUUUGUGGAUAACGCUUGUUUUAUUACAGG proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z38002
spoIIR spoIIR ND ND ND ND ND
ywkF ywkF 3794860..3794905 -14.4 AAAAAGGAAGCCUCUUAGGCUUCCUUUUUUUGCAGUAAA proposed; downstream gene is on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z49782
ywkA,ywkB ywkAB 3798366..3798408 -13.2 AAAAAGCUCCCUUUAAGGGAGCUUUUUGCUUUAGGUU Northern blotting (2.8 kb transcript); genes further downstream are on the opposite strand 12949160 (Doan et al., Microbiology 2003, 149(Pt.9):2331-2343); Genbank Z49782
rpmE rpmE 3802055..3802098 -14.0 CUCAACAGGCAAGCAGCAGUCUUGCCUGUUUUUUAUAUUGUCU proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z49782
ywjI ywjI 3804077..3804119 -14.8 AAAAAGCGGGUGUGAGCCCGCUUUAACUUUUGCAGA proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z49782
fbaA,ywjH fbaA-ywjH 3806726..3806780 -25.0 AUGAAAGGGGCGGCAAACAGCUUUAUGCCUGUUUGCCGCGGCCUUUGUAUUUCACCGAC Northern blotting (1.7 kb transcript) 2457578 (Trach et al., J. Bacteriol. 1988, 170(9):4194-4208); 11489127 (Ludwig et al., Mol. Microbiol. 2001, 41(2):409-422) A readthrough terminator GAACTTTTTATAGCCGCCTGACAGCTTGACAGGCGGTTTTCCGTCTATCTTTAGAAAG was found downstream of fbaA at 3807499..3807556, leading to a 1.0 kb transcript.
spo0F spo0F ND ND ND lacZ transcriptional fusions 2457578 (Trach et al., J. Bacteriol. 1988, 170(9):4194-4208) The stem-loop TGACAAAAAGAAGAAACAAATGAATCATGTCATTATGTTGCCGAT (dG = -8.6 kcal/mole) proposed by Trach et al. at position 3808531..3808575 seems too weak to function as a terminator.
ywjG ywjG 3809658..3809717 -13.4 AAAAAGACUUGCCCGCUUUUGACAAACGGCAAGUCUUUUUUAUUACUUCU proposed 2457578 (Trach et al., J. Bacteriol. 1988, 170(9):4194-4208) The indicated terminator was found by mfold. Trach proposes this terminator for the convergently transcribed pyrG gene, but proposes the terminator TCGTTTACACTAAAAGAAATTCTGCAAGAGTATGCATAATATCTTATTGTACATGCTGGAACTTGC (dG= -7.0 kcal/mole) at position 3809596..3809661 for ywjG.
pyrG pyrG 3809671..3809729 -17.9 AAAAAGACUUGCCGUUUGUCAAAAGCGGGCAAGUCUUUUUUAUUUGUUUC proposed 2457578 (Trach et al., J. Bacteriol. 1988, 170(9):4194-4208) Bidirectional terminator. Synonym: ctrA.
rpoE rpoE 3811426..3811474 -24.1 GUUAUGCUCCCUUUCAAGAAAUUGAAAGGGAGCUUUCUUAUUUUCACC proposed 2457578 (Trach et al., J. Bacteriol. 1988, 170(9):4194-4208)
ywjC ywjC 3818192..3818244 -13.3 AAAAAGGAUAGACAUCUGUCUAUCCUUUUUCUUAUGCUCU proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z49782 bidirectional terminator
ywjB ywjB 3818211..3818253 -13.3 AAAAAGGAUAGACAGAUGUCUAUCCUUUUUUGUAUGUAAG proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z49782 bidirectional terminator
ywjA ywjA ND ND ND proposed 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629)
narG,narH,narJ,narI narGHJI 3822551..3822589 -15.9 AAAAUCCCCCUUGCAAGAGGGGGUUUUUUCUGCCAAGG proposed 8846791 (Cruz-Ramos et al., EMBO J. 1995, 14(23):5984-5994); Genbank Z49884
arfM arfM 3829146..3829192 -12.9 UGAGCCCGGUUCUUAAAUAGAGCCGGUUUUUUUUGAUCUUU proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z97884
narK,fnr narK-fnr 3830502..3830546 -12.8 AAAAACAAGGACAGCGGUGUCCUUGUUUUUUUACCUUGUG Northern blotting (2.0 kb transcript) 8846791 (Cruz-Ramos et al., EMBO J. 1995, 14(23):5984-5994) Internal promoter in front of fnr, leading to a 0.7 kb monocistronic fnr transcript. A stem-loop structure between narK and fnr apparently does not function as a terminator
argS argS 3832631..3832675 -17.9 CAAAAGGACAAAGUCUUCGGGCUUUGUCCUUUUUUUAUGAGAAA proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z97024
sboA,sboX,albA,albB,albC,albD,albE,albF,albG sboAX-albABCDEFG ND ND ND proposed 10572140 (Zheng et al., J. Bacteriol. 1999, 181(23):7346-7355) The terminator structure proposed in Genbank Z97024 lacks a T-stretch. A potential readthrough terminator CTATGGGGGTAAGGATCTCCCAAAAGGGCATAGTCATTCTACTATGCCCTTTTTAA exists at 3835201..3835256 downstream of sboA.
phrF phrF 3846267..3846298 -12.0 UUUAACCGCCGUCCAUCGGCGGUUUUUUCGUCCCCUC proposed 11466295 (McQuade et al., J. Bacteriol. 2001, 183(16):4905-4909); Genbank Z80360
ywhH ywhH 3846829..3846881 -15.1 AAAAACAUCCAGACAUCGUCUGGAUGUUUACUUAUUUCACA proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z80360 bidirectional terminator
speB speB 3846840..3846893 -15.1 GUAAACAUCCAGACGAUGUCUGGAUGUUUUUUUAUUCCCAG proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z80360; SubtiList bidirectional terminator
speE speE 3847772..3847805 -15.2 GUAUGGCGCAGGAGCGAAUCUUGCGCUUUUUUACAGGAAAG proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z80360
ywhE ywhE ND ND ND upstream and downstream genes are transcribed in the opposite direction ND
ywhA ywhA 3852692..3852735 -18.4 UAAAAGCCGGUGCGCGAAGCGCCGGCUUUAUAGAGAUUAUU proposed; downstream gene is on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z80360
mmr mmr 3855734..3855789 -21.2 AUCAACACAUUCGUCCCUUUUAGAGGGAUGGGUGUGUUUUUUUAUUUGAAU proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywgA ywgA 3857979..3858032 -15.0 ACCAAGCAAAAGAAAUGAUCCGUUUCUUUUGCUUUUUUUAUUGACAA proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); Genbank Z80355 (aagcaaaaga aatgatccgt ttcttttgct t)
rsfA rsfA 3861226..3861275 -17.9 AAAAAUCCCAAAACGGGCAGCUGUUUUGGGAUUUUCGCCAUGUGCA upstream and downsteam genes are in the opposite direction 7934828 (Glaser et al., Mol. Microbiol. 1993, 10(2):371-384)
ywfL ywfL 3862392..3862437 -24.5 UCUUCGCAUGCCGGCUGUAUAUGCCGGCAUGCAUUUUUUAUCUCAAGC proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywfK ywfK ND ND ND proposed 12169591 (Guillouard et al., J. Bacteriol. 2002, 184(17):4681-4689) synonym: cysL
pta pta 3864331..3864368 -21.0 ACAAUGGCAGCUCUCGACCGAGGGCUGCCUUUUUUGCGCUUCUG proposed 10423526 (Shin et al., J. Biochem. (Tokyo) 1999, 126(2):333-339)
ywfI ywfI 3866375..3866432 -14.0 CCCCGCCCGCCCUAUCCGGCGGGAGUUUUUCAAUUCUCCU proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywfA ywfA 3873299..3873353 -7.9 AAAAACCCUUUUUAAAGGGUUUUUUUGUUUGUAU proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
rocA,rocB,rocC rocABC 3874764..3874809 -19.0 AAAAAGCUCUCCGGGAGGCCGGAGAGCUUUUUUUACGUGUUA proposed 8113162 (Calogero et al., J. Bacteriol. 1994, 176(5):1234-1241); SubtiList
rocG rocG 3879722..3879755 -7.6 CCUCCGCAAAAUAAUUUUGCAUUUGUUUUUUGCGUA proposed 10468601 (Belitsky & Sonenshein, Proc. Natl Acad. Sci. USA 1999, 96(18):10290-10295)
yweA yweA 3881165..3881205 -14.7 AGUCAGAGACUGAGAUGUUUUCAGUCUCUUUUUUUGUGGAUUC Northern blotting (0.6 kb transcript) 10468601 (Belitsky & Sonenshein, Proc. Natl Acad. Sci. USA 1999, 96(18):10290-10295); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165)
spsL spsL 3881952..3881993 -14.0 AUCAAUCGAAGAGCAGAGGCAUCUUCGACUUUUUUUGCCCUUUU proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywdL ywdL 3892993..3893048 -17.9 AAAAAGCCAAUCACUCAUAUGAUGAGGAUUGGCUUUUUUGUUUAUAGA proposed; upstream and downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList bidirectional terminator
ywdI,ywdJ,ywdK ywdIJK 3893003..3893066 -17.9 AAAAAGCCAAUCCUCAUCAUAUGAGUGAUUGGCUUUUUUCUUAUCUUG Northern blotting (2.2 kb transcript); downstream gene is on the opposite strand 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList bidirectional terminator
ywdH ywdH 3896665..3896720 -11.6 AAAAAGCGCAGAUCACCUGCGCUUUUUACAAAUCCUU proposed; upstream and downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList bidirectional terminator, assumed same as ung.
ung ung 3896673..3896710 -11.8 AAAAAGCGCAGGUGAUCUGCGCUUUUUUAUUUGAGUA proposed; downstream gene is on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList bidirectional terminator
thiD thiD 3900784..3900838 -22.0 AAAAGGGGCUGCCUUACAGAGAGGCAGCCCUUUUUAAAUCACCGA proposed 3100393 (Fouet et al., Gene 1986, 45(2):221-225); SubtiList
sacP,sacA,ywdA sacPA-ywdA 3900846..3900917 -13.4 ACAGGCUGCCGAUGGGAUCGGCAGUUUUUUCUGUGAAAA proposed 2163394 (Debarbouille et al., J. Bacteriol. 1990, 172(7):3966-3973); 3100393 (Fouet et al., Gene 1986, 45(2):221-225) the terminators suggested by Fouet et al. are located behind the ywdA gene, whose existence was unknown.
ywcJ ywcJ ND ND ND proposed; upstream and downstream genes are on the opposite strand 8846791 (Cruz-Ramos et al., EMBO J. 1995, 14(23):5984-5994); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328)
sacT sacT 3905122..3905168 -12.5 UUUGACUUGCAGGGAGUGAUCUCUGGAAGUUUUUUUAUUGAUCA proposed; downstream gene is on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
vpr vpr 3909275..3909320 -20.0 AAAAAGCCCUGCCGAUUCGGCAGGGCUUUUUAAAGAUCAGU proposed; upstream and downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
nfrA,ywcH nfrA-ywcH 3909286..3909329 -20.0 AAAAAGCCCUGCCGAAUCGGCAGGGCUUUUUCUUAUUCAAC Genetic analysis; Northern blotting (2.0 kb transcript); downstream gene is on the opposite strand 10913069 (Moch et al., J. Bacteriol. 2000, 182(16):4384-4393) SubtiList and also Presecan et al. (9353933) show a terminator GGCTTTAATAAAAACTAAAGCAAACCTCTCCGTCTGGAGGGGTTTTTATGTTTCACGTGTAAC at 3910455..3910517 between nfrA and ywcH. Moch suggests that this stem-loop may function as a (readthrough?) terminator, even though nfrA and ywcH constitute an operon.
rodA rodA 3911320..3911364 -16.0 AUGCAGACAGCCUUUACAGAGGCUGUCUUUUUUUGUGCAGAG proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywcE ywcE 3913289..3913339 -13.9 AAAAACCCUCUUCCACUGAAGAGGGUUUUUUGUAUUAUUC proposed; upstream and downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList bidirectional terminator
qoxD qoxD 3913300..3913354 -15.2 AAAAACCCUCUUCAGUGGAAGAGGGUUUUUUGCUGUCUUC proposed; upstream and downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList bidirectional terminator
ywzA ywzA 3918029..3918086 -19.0 AGCAGCACCCGAAGCGUCAGCGCUUUGGGUGUUUGUUUUGCCAUAA proposed; upstream and downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328)
galK,galT galKT 3918091..3918135 -18.4 CAAAAGCCUCAACCGCUAGGGUUGAGGCUUUUUUCGAUUUUUA proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList bidirectional terminator
ywbO ywbO 3924784..3924833 -11.2 AAAAAGCUCUCGAUAAAGAGAGCUUUUUUUAUUCCUGU proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywbN ywbN ND ND ND proposed 9636707 (Huang et al., J. Mol. Biol. 1998, 279(1):165-173); 9683469 (Huang et al., J. Bacteriol. 1998, 180(15):3765-3770) the terminators predicted by Presecan (9353933) suggest that ywbN is part of a ywbLMN operon
ywbL ywbL ND ND ND proposed 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629) the terminators predicted by Presecan (9353933) suggest that ywbL is part of a ywbLMN operon
ywbI,thiM,thiE ywbI-thiME 3929679..3929733 -12.8 AAAGGGCUGUUCUGUAAAAGGACAGCUUUUUUGCUGUCCAU Northern blotting (2.4 kb transcript) 9139923 (Zhang et al., J. Bacteriol. 1997, 179(9):3030-3035)
ywbC ywbC 3936522..3936575 -15.6 AUAAAGAACGUACAUUUUGUGAUGUACGUUCUUUUUUAUCUAUACC proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList bidirectional terminator
ywbB ywbB 3936535..3936582 -14.5 AAAAAGAACGUACAUCACAAAAUGUACGUUCUUUAUUUUUACCGCU proposed; downstream gene is on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList bidirectional terminator
epr epr 3940819..3940876 -16.6 AAAAACCUUUAAGAUUUGCAUUCCAAGUCUUAAAGGUUUUUUUCAUUCUAA proposed 3142851 (Stroma et al., J. Bacteriol. 1988, 170(12):5557-5563); 1400159 (Crutz & Steinmetz, J. Bacteriol. 1992, 174(19):6087-6095)
sacX,sacY sacXY 3943521..3943575 -13.4 AAAAACGCUUUUGAUCAUCUCAAAAGCGUUUUUUUAUCUGAUU lacZ gene fusion 1400159 (Crutz & Steinmetz, J. Bacteriol. 1992, 174(19):6087-6095); 2116367 (Zukowski et al., Gene 1990, 90(1):153-155) bidirectional terminator
gspA gspA 3943534..3943591 -14.1 AAAAACGCUUUUGAGAUGAUCAAAAGCGUUUUUUGUUUGUCUC Northern blotting (0.95 kb transcript) 7768864 (Antelmann et al., J. Bacteriol. 1995, 177(12):3540-3545) bidirectional terminator
tyrZ tyrZ 3947417..3947468 -12.9 CGAAACGCUUAUGACCCUUCAUUCAUAAGCGUUUUUUUGCAGGUAU proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
ywaD ywaD 3948930..3948977 -16.2 AAAAAGACGGCACUUGGGUGCCGUCUUUUUUAAUCCACUU proposed; downstream genes are on the opposite strand 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList bidirectional terminator
ywaC ywaC 3948938..3948998 -15.7 AAAAAGACGGCACCCAAGUGCCGUCUUUUUUUAUUUGAUA downstream genes are on the opposite strand 11866510 (Cao et al., J. Mol. Biol. 2002, 316(3):443-457); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList bidirectional terminator
menA menA 3949710..3949757 -11.2 AAAAAGACCGCUCGUUUCAUGCGGUCUUUUUUUGUUACAAU proposed 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328); SubtiList
dltA,dltB,dltC,dltD,dltE dltABCDE 3956244..3956287 -16.6 AACACGCAGGAGAAUUAAUUUCUCCUGCUUUUUUCAUAUGAAU proposed 7797557 (Perego et al., J. Biol. Chem. 1995, 270(26):15598-15606)
ywaA ywaA 3957492..3957538 -16.2 AAAAAGCCGGCCCAUUACAGGCCGGCUUUUUUUACGCUUCA Northern blotting (1.3 kb transcript); downstream genes are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); 9353933 (Presecan et al., Microbiology 1997, 143(Pt.10):3313-3328) bidirectional terminator
licB,licC,licA,licH licBCAH 3957502..3957551 -19.6 AAAAAGCCGGCCUGUAAUGGGCCGGCUUUUUUCUUACUUGC Northern blotting (3.4 kb transcript) 8990303 (Tobisch et al., J. Bacteriol. 1997, 179(2):496-506); Genbank Z49992 bidirectional terminator
licR licR ND ND ND Northern blotting (2.0 kb transcript) 8990303 (Tobisch et al., J. Bacteriol. 1997, 179(2):496-506) Tobisch at el. propose the terminator structure UAUACCUUUUUUCCGUUGCUGCGGAAAAACCCUGAGUGUUUAU (dG = -12.1 kcal/mole) at position 3960971..3961013 downstream of licR. However, this stem-loop structure is missing a T-stretch.
yxlJ,yxzF yxlJ-yxzF 3963093..3963135 -13.4 UAGAACAGCCGGCUGAUCCCGGCUGUUUUUUUAUAGGUCA Northern blotting (0.9 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); 8990303 (Tobisch et al., J. Bacteriol. 1997, 179(2):496-506) The 0.9 kb transcript is sufficient to cover both yxlJ and yxzF. The figure in Yoshida's paper suggests a yxlJ-yxzF transcript, but such an operon is not mentioned in the text. Internal promoter in front of yxzF.
katX katX 3965655..3965704 -17.7 GCGAACAGGGCUUUUUUAGAAGCCCUGUUUUUUUAUUUUUCU Northern blotting (1.8 kb transcript) 10503549 (Petersohn et al., Mol. Gen. Genetic. 1999, 262(1):173-179); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
sigY,yxlC,yxlD,yxlE,yxlF,yxlG sigY-yxlCDEFG 3965789..3965845 -13.1 AAAAACGGCGTGATCTAAAGCGCCGATTGTTTTTTTCTGAG Northern blotting (4.3 kb transcript) 14769884 (Tojo et al., J. Biochem. 2003, 134(6):935-946); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) Both Tojo and Yoshida found mRNA transcripts (4.2 kb, 4.3 kb, and 4.8 kb) that extended into the coding region of the downstream yxlH gene.
yxlA yxlA 3971423..3971467 -16.3 GAAAAGCUGUCUUCUCUCUGAAGACAGCUUUUUUAUCAUUCAA Northern blotting (1.5 kb transcript); upstream and downstream genes are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF
yxkO yxkO 3971430..3971475 -16.6 AAAAAGCUGUCUUCAGAGAGAAGACAGCUUUUCUUGAUACCCC Northern blotting (1.0 kb transcript); downstream gene is on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
cydA,cydB,cydC,cydD cydABCD 3972352..3972387 -13.2 UAAAAGACAGCCCUAAAAGGCUGUCUUUUUUGUUUGAAAA Northern blotting (6.0 kb transcript) 9852001 (Winstedt et al., J. Bacteriol. 1998, 180(24):6571-6580); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) Various shorter transcripts were found by Yoshida, which may be a result of the mRNA molecule being highly unstable (see Winstedt).
yxkJ yxkJ 3980114..3980169 -17.7 CGCAAGCAAGUUCUUCGUCAAACGAAAGAGCUUGCUUUUUUGCAUGUCCA Northern blotting (1.5 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF A shorter (0.7 kb) transcript was also measured. Its significance is unclear.
yxkI yxkI ND ND ND Northern blotting (2.0 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) A 1.1 kb and a 2.0 kb transcript were found. The 1.1 kb transcript is too short to cover the yxkI gene. The 2.0 kb transcript may be long enough to cover yxkI and the downstream yxzE, but is not indicted as such in Yoshida's paper.
yxzE yxzE 3982168..3982211 -17.9 GGAGGGGGCGGCGAUUAAACGCCGCCUUUUUUUAUUUCAUUG downstream genes are on the opposite strand 9987136 (Huang et al., Mol. Microbiol. 1999, 31(1):361-371); SubtiList
yxkH yxkH 3982062..3982089 -10.0 GCUGUCCGCCUGCUGGCGGCUUUUGUUUUUCGAGG Northern blotting; downstream gene is on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF A 1.0 kb and a 1.2 kb transcript was found. The significance of the two transcript lengths is unknown.
yxkF,msmX yxkF-msmX 3983110..3983151 -19.7 AAAAACCGGACAUGGAGACAUGUCCGGUUUUUUGCUAUUGAA Northern blotting (2.3 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF; SubtiList internal promoter in front of msmX, leading to a 1.3 kb transcript.
yxkD yxkD 3986903..3986957 -17.0 AAAAAUCCCUCUGUACUUGAAACAGAGGGAUUUUUUCAUUUAGAA Northern blotting (1.1 kb transcript); upstream and downstream gene are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxkC yxkC 3988881..3988931 -16.8 AACAAGGGUGCCUGUUUAGGCACCCUUGUUCUUUAAAAAA Northern blotting (0.7 kb transcript); downstream gene is on the opposite strand 15033535 (Serizawa et al., Gene 2004, 329:125-136); 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
galE galE 3988912..3988984 -18.5 AUGGAGGCCUUCUCAAUUGAGAAGGCCUUUUUUAAAGAACAA Northern blotting (1.2 kb transcript); downstream gene is on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF
yxjN yxjN ND ND ND Northern blotting (0.6 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
pepT pepT 3995322..3995366 -17.0 CAAAAGCCAGUCCAAAAAAGGACUGGCUUUUUUGUGUGAAAA Northern blotting (1.4 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF; SubtiList A longer (2.0 kb) transcript was also detected. Its significance is unclear.
yxjJ,yxjI yxjJI 3996914..3996952 -17.7 UUCAAGCUCUUCCUUACACAAAGGAAGAGCUUUUUACAUGCUUAA proposed 9537385 (Dartois et al., J. Bacteriol. 1998, 180(7):1855-1861) Northern blotting experiments by Yoshida (10746760) show various transcripts of different lengths, some long enough to cover a yxjIJ operon. Internal promoter in front of yxjI.
yxjH yxjH 3998297..3998342 -17.7 CGCAAGCUCUUCCUUAUCCAAAGGAAGAGCUUUUUUAUAUUUGAA Northern blotting (1.5 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); 10094622 (Grundy & Henkin, Mol. Microbiol. 1998, 30(4):737-749)
yxjG yxjG 3999497..3999557 -17.1 AAAAACACACUUGAUUCCCUAGCGGAGCAAGUGUGUUUUUAAUGUCAUUG Northern blotting (1.5 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); 10094622 (Grundy & Henkin, Mol. Microbiol. 1998, 30(4):737-749); SubtiList bidirectional terminator
yxjC,scoA,scoB,yxjF yxjC-scoAB-yxjF 3999511..3999572 -15.9 AAAAACACACUUGCUCCGCUAGGGAAUCAAGUGUGUUUUUUUCUUUGCUU Northern blotting (3.8 kb transcript) 12662922 (Eichenberger et al., J. Mol. Biol. 2003, 327(5):945-972); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF; SubtiList bidirectional terminator
yxjB yxjB 4003265..4003318 -9.6 GGAAAGCUCCGAAAAAAGGAGCUUUCCUUUUUUAAUC Northern blotting (1.0 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); SubtiList
yxjA yxjA 4005964..4006005 -20.1 ACAUUGAGCCAUAUCCCUUUUCGGAUAUGGCUCUUUUCAUUAUUGAUA Northern blotting (1.3 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579);BSORF; SubtiList The Northern blotting results in BSORF show a 1.5 kb and a 2.5 kb transcript.
yxiT yxiT 4005962..4006002 -22.8 CAAUAAUGAAAAGAGCCAUAUCCGAAAAGGGAUAUGGCUCAAUGUUUCUACCACACA Northern blotting (0.8 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) The genome sequence between yxiT and the indicated terminator contains an ORF homologous to Bacillus licheniformis BL05383, yjeAA (BL00500), and Clostridium perfrigens gene CPE2311. Another potential terminator CUAUAUAGCUAUAUCAAAAAACACGAUGUGCUGUUUUUCUCUGAUGUA is located 250 base-pairs downstream of the yxiT stop codon. The indicated terminator agrees better with the Northern blotting result.
katE,yxiS katE-yxiS 4006789..4006836 -9.4 AAAAAGAGACAUCCUGUGUCUCUUUUUUUAUUGGAAA Northern blotting (2.5 kb transcript measured by Yoshida; 2.4 kb transcript measured by Engelmann) 7559348 (Engelmann et al., J. Bacteriol. 1995, 177(19):5598-5605); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) Synonym: katB-yxiS
citH citH ND ND ND Northern blotting (1.5 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
licT,bglS licT-bglS 4010814..4010855 -19.3 UGAAAGAGCCUGCUGCAAUAUAGCAGGCUCUUAUGAUUGUAAUGA Northern blotting (2.4 kb transcript) 8606172 (Schnetz et al., J. Bacteriol. 178(7), 1971-1979, 1996) A terminator-antiterminator structure ACATTCACATATGAAAATGGTAGGATTGTTACTGATAAAGCAGGCAAAACCTAAATTGCAATGAGTGCGGATCATCTCTGTCTGTGCTGATGGTAATTTAGGTTTTTATTTTTTTCAGAGGGAAGATGATGATAGTTACAGGATTCAAGTTAGTAAGATT was found at position 4011681..4011840 downstream of licT, leading to a 0.9 kb transcript)
yxiO yxiO 4014959..4015013 -10.6 GCUGACACACCGUCAAUUUUGGCAAUCGUUCCUACAAAAUCAACGGCUCUGAUUUUCUUUUUCUUUC Northern blotting (1.5 kb transcript); upstream and downstream genes are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF The Northern blotting results also show a 0.7 kb transcript, which would be too short to cover yxiO.
yxiM,deaD yxiM-deaD 4014964..4015015 -22.1 AUGAAUGACCUGCUCCCAGUUAAAGGGGCAGGUCAUUUUGCUGCUGGCUG Northern blotting (2.7 kb transcript); downstream genes are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) Internal promoter in front of deaD, leading to a 1.6 kb transcript. A short (500 bp) transcript was found at the beginning of yxiM.
wapA,yxxG wapA-yxxG 4021841..4021889 -17.0 AUAAAGCUUGUAUCGAUAAGCGAUACAAGCUUUUUUAGAACAAAU Northern blotting (8.0 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxxF yxxF 4029691..4029741 -10.0 UAAAAAGGCCUAUGCGGCCUUUUUUUGUUUUAGGU Northern blotting (1.0 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); SubtiList
bglP,bglH,yxiE bglPH-yxiE 4030776..4030814 -11.9 AAAAAGCGCCCUUGGGCGCUUUUUUUUAUUUAGA Northern blotting (4.0 kb transcript) 10913081 (Antelmann et al, J. Bacteriol. 2000, 182(16):4478-4490); 7883710 (Le Coq et al., J. Bacteriol. 1995, 177(6):1527-1535); 8626332 (Kruger et al., J. Bacteriol. 1996, 178(9):2637-2644); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) Internal promoter in front of yxiE, leading to a 0.5 kb transcript.
yxiD,yxxD,yxxE yxiD-yxxD-yxxE 4034936..4035001 -12.3 CAUAACCUUGAUUGGAAAAAAUGCCUUUCAAGGUUUUUAAUUACAAUA proposed 7883710 (Le Coq et al., J. Bacteriol. 1995, 177(6):1527-1535) yxiD and yxxD overlap. Northern blotting by Yoshida (10746760) showed one 1 kb transcript in the yxiD-yxxD region and one 700 bp transcript for yxxE. Both of these transcripts are too long to infer that these genes are transcribed monocistronically, but too short to cover a yxiD-yxxD-yxxE operon. The stem-loop GCAAAACCUAAAUGGUGCAGGUGCAGGAGGAGACUCUCGCAAUCUGUGUCAUUU (dG = -23.7 kcal/mole) further downstream at position 4034736..4034789 (listed in SubtiList) is part of the terminator-antiterminator complex in front of bglP.
yxiB yxiB ND ND ND Northern blotting (0.3 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxiA yxiA 4038447..4038491 -10.0 GAAGCGCCUUCGAGGGAAGGUGUUUUUUUAUGAGCUU Northern blotting (1.5 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579);BSORF; SubtiList
hutP,hutH,hutU,hutI,hutG,hutM hutPHUIGM 4047970..4048028 -13.7 AAAAAGCACACCCCGCUCAGCAUGGGAUGUGCUUUAUUUUUUAUUCU Northern blotting (8.0 kb transcript); 5' primer extension analysis of hutP, hutH, and hutU 7704263 (Yoshida et al., Microbiology 1995, 141(Pt.2):337-343); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); 14763987 (Oda et al., Mol. Microbiol. 2004, 51(4):1155-1168); 2454913 (Oda et al., J. Bacteriol. 1988, 170(7):3199-3205); 8071225 (Wray & Fisher, J. Bacteriol. 1994, 176(17):5466-5473); 10712704 (Oda et al., Mol. Microbiol. 2000, 35(5):1244-1254) A terminator/antiterminator structure was found between hutP and hutH (terminator CATATGAAACAGCCCATAGATCTTAGACGATAGGGGGCTATGCGTGAAAACAGAAGTTCACAGCATAGCTCCTTTTTGTATGGGCGCTTTACCAAAGTAAAGAAAAAGGAGTT at position 4040721..4040833), leading to a 0.6 kb transcript.
deoR,dra,nupC,pdp deoR-dra-nupC-pdp 4047986..4048037 -17.2 AUAAAGCACAUCCCAUGCUGAGCGGGGUGUGCUUUUUUAAUUAUAGG Northern blotting (4.5 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); 7704263 (Yoshida et al., Microbiology 1995, 141(Pt.2):337-343); 8550462 (Saxild et al., J. Bacteriol. 1996, 178(2):424-434) Bidirectional terminator. A 3.4 kb dra-nupC-pdp transcript was also detected, as well as a monocistronic (1.0 kb) dra transcript terminating at the putative readthrough terminator CAGGCGGAGACAACTATTAAGAGCTGACGGAAGGCAGACTGCTTTCCGTTTTCTGAGGAAACAGTAATTGTAAGCG at position 4050564..4050639 downstream of dra. Northern blotting results by Yoshida also showed a monocistronic (0.8 kb) deoR transcript.
yxeR,yxxB yxeR-yxxB 4052434..4052469 ND ND Northern blotting (2.4 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) yxeR and yxxB monocistronic transcripts (1.4 kb and 1.0 kb, respectively) were also detected
yxeK,yxeL,yxeM,yxeN,yxeO,yxeP,yxeQ yxeKLMNOPQ ND ND ND Northern blotting (7.0 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF
yxeI,yxeJ yxeIJ ND ND ND Northern blotting (1.2 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF
yxeF,yxeG,yxeH yxeFGH 4062656..4062700 -17.7 AAAAAAUCCAGCCUUCUAAAGGCUGGAUCUUUUCGUUUUAUUUG Northern blotting (2.5 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); SubtiList; BSORF Internal promoter in front of yxeH, leading to a 0.9 kb transcript.
yxeE yxeE 4064956..4065025 -4.3 UGUAGUUCCUCUUUGACGGAAUUUCUUUUCAUUCAA Northern blotting (0.4 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxeD yxeD 4065569..4065623 -19.1 UAAAAGGCUCAACACAAUGCGAGUGUUGAGCCUUUUUCCUUACUGUU Northern blotting (0.4 kb transcript); downstream gene is on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); SubtiList
yxeC yxeC 4065577..4065628 -18.9 AAAAAGGCUCAACACUCGCAUUGUGUUGAGCCUUUUAUAUGUUACUG Northern blotting (0.5 kb transcript); upstream and downstream gene are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxeB yxeB 4067141..4067200 -17.4 AAAAACGGCACAGUCAUGACGCUGUGCCGUUUUUUAUGAUUCAC Northern blotting (1.1 kb transcript); upstream and downstream genes are on the opposite strand 12354229 (Baichoo et al., Mol. Microbiol. 2002, 45(6):1613-1629); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF; SubtiList
yxdJ,yxdK yxdJK 4070247..4070296 -18.4 UUGUUUCCCCUUGAUAACAUGGAUUUAUGUCAAGGGGAUUUUUAUGUUGAACG Northern blotting (1.7 kb transcript) 7952181 (Yoshida et al., Microbiology 140(Pt.9):2289-2298); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
mmsA,iolB,iolC,iolD,iolE,iolF,idh,iolH,iolI,fbaB mmsA-iolBCDEF-idh-iolHI-fbaB 4072060..4072099 -8.1 GAAACCGCCGAGAUGGCGUGUUUUUUUGUGCGGUG S1 nuclease mapping of the 3' end; Northern blotting (11.5 kb transcript) 7952181 (Yoshida et al., Microbiology 1994, 140(Pt.9):2289-2298); 9226270 (Yoshida et al., J. Bacteriol. 1997, 179(14):4591-4598); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) The proposed terminator agrees well with the experimentally determined termination site in the TTTTTTT stretch.
iolR,iolS iolRS 4085550..4085601 -21.5 GAAAACAGCCUUCUCCAAUGGAGAAGGCUGUUUUUUUGUGCGAUA Northern blotting (2.0 kb transcript); S1 nuclease mapping of the 3' end (transcription ends in the CTGT region just in front of the T-stretch) 9226270 (Yoshida et al., J. Bacteriol. 1997, 179(14):4591-4598)
yxcE,yxcD yxcED 4086779..4086830 -11.5 UCAAACCUUACUCCGCGCGGGUAAGGUUUUUUUAAUGGUUU Northern blotting (1.2 kb transcript) 10376822 (Akbar et al., Microbiology, 1999, 145(Pt.5):1069-1078); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
csbC csbC 4088392..4088448 -20.0 AAAAAGGAAUCGUCUCCUUAUGAGACGAUUCCUUUUUCUGUUUACAC Northern blotting (1.5 kb transcript) 10376822 (Akbar et al., Microbiology, 1999, 145(Pt.5):1069-1078); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); BSORF
htpG htpG 4088404..4088453 -21.4 AAAAAGGAAUCGUCUCAUAAGGAGACGAUUCCUUUUUUUAUAAUGUA Northern blotting (1.9 kb transcript) 9150201 (Schulz et al., J. Bacteriol. 1997, 179(10):3103-3109)
yxbG yxbG 4091656..4091711 -13.0 AAUAAGAGAGGGAGCCCCCUCUCUUUUUGUCUUUUAAA Northern blotting (0.9 kb transcript); upstream and downstream gene are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxbF yxbF 4091673..4091721 -17.0 ACAAAAAGAGAGGGGGCUCCCUCUCUUAUUUCGUUUCUUCCUU Northern blotting (1.3 kb transcript); upstream and downstream gene are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
aldX aldX 4094339..4094382 -15.5 CAAAAGGCGCUUCCUUAGAGGAGCGCCUUUUAUUGUAACUCC Northern blotting (1.3 kb transcript); downstream gene is on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); SubtiList
yxbC,yxbD yxbCD 4094345..4094392 -15.5 UAAAAGGCGCUCCUCUAAGGAAGCGCCUUUUGAUCAUGCGAU Northern blotting (2.3 kb transcript); downstream gene is on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) A readthrough terminator may exist downstream of yxbC, leading to a 1.1 kb transcript.
yxbB,yxbA,yxnB,asnH,yxaM yxbBA-yxnB-asnH-yxaM 4101393..4101445 -24.4 AUCACAGUAAGAAGACCUUCUUAUUAAAAGAAGGUCUUCUGCUAUUCUAUUCAGUUAUU Northern blotting (5.5 kb transcript) 10498721 (Yoshida et al., J. Bacteriol. 1999, 181(19):6081-6091); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) Yoshida et al. (10746760) found several shorter transcripts, starting at the promoter in front of yxbB. These transcripts are not mentioned in Yoshida's 1999 paper.
yxaJ,yxaL yxaJL 4101398..4101447 ND ND Northern blotting (2.0 kb transcript); genes downstream are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) an internal promoter exists in front of yxaL, leading to a 1.4 kb transcript
yxaI yxaI 4103926..4103969 -16.7 AAAAAGUCUAGACGCCAAUAGGCAUCUAGACUUUUGUUUUCUUUGC Northern blotting (0.6 kb transcript); upstream and downstream genes are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxaG,yxaH yxaGH 4103921..4103966 -19.5 CAAAAGUCUAGAUGCCUAUUGGCGUCUAGACUUUUUUCUAUUAUUU Northern blotting (2.5 kb transcript) 15317768 (Yoshida et al., J. Bacteriol. 2004, 186(17):5640-5648); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxaF yxaF ND ND ND Northern blotting (0.7 kb transcript); upstream gene is on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxnA yxnA 4108148..4108206 -12.3 AAAAACCCAUGCUGUUCCAGCGAACCAUGGGUUUUUCAGCUGUUAA Northern blotting (1.1 kb transcript); upstream and downstream gene are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxaD yxaD 4108163..4108220 -12.7 AAAAACCCAUGGUUCGCUGGAACAGCAUGGGUUUUUCUUAUGGUCA Northern blotting (0.6 kb transcript); upstream and downstream gene are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxaC yxaC 4109922..4109973 -16.1 AGAAAGACUGCCCCGGGGGAGGGCAGUCUUUUUCGUUUAAGAA Northern blotting (1.3 kb transcript); upstream and downstream genes are on the opposite strand 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579)
yxaA,yxaB yxaAB 4109932..4109989 -18.9 AAAAAGACUGCCCUCCCCCGGGGCAGUCUUUCUUUGUUAAAUA Northern blotting (2.4 kb transcript) 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579); SubtiList
gntR,gntK,gntP,gntZ gntRKPZ 4117508..4117557 -14.2 AAAAACACGGUCAGUUUCAACUGAACCGUGUUUUUUUCUUCUAUC S1 nuclease mapping; Northern blotting (5.5 kb transcript) 3020045 (Fujita et al., J. Biol. Chem. 1986, 261(29):13744-13753); 10746760 (Yoshida et al., Microbiology 2000, 146(Pt.3):573-579) Main termination site, as determined by S1 nuclease mapping, is at position 4117549 (first T in the T stretch TTTTTTTCTT). Fujita et al. (3020045) show that two internal promoters exist, for unknown sigma factor, upstream of gntZ. Yoshida shows a monocistronic 2.0 kb gntZ transcript.
ahpC,ahpF ahpCF 4120074..4120135 -24.0 AGAAAUCCGCUAUAUUGCCAGAUUGGCAGGAUAGCGGAUUUUUCUUUUUCUAC Northern blotting (2.4 kb transcript) 8932314 (Antelmann et al., J. Bacteriol. 1996, 178(22):6571-6578); BSORF; SubtiList
yyzE,bglA yyzE-bglA 4120138..4120188 -21.4 UGGUGAGGAACUAUAAGAAGCGCUCGAAUCGAGCACUUUUACCGUAGUGCCUGGUUCGGUUUUUUUCUGUAGAA Northern blotting BSORF; SubtiList
yydK yydK 4123210..4123245 -7.6 AAUCCAAUGAACUACUUUAUCGUAUUCAUUAUCUUUUUCCUCUUUGUA Northern blotting; upstream and downstream genes are on the opposite strand BSORF
yydF,yydG,yydH,yydI,yydJ yydFGHIJ 4123206..4123249 -13.8 AGGGAGCUACUUCACAAUGAAGUAGCUUUUUAUGUGCACCU Northern blotting BSORF; SubtiList
fbp fbp 4129352..4129431 -13.8 AAAAAAAGUCCAUUCUAUAUAACUCUCGCUAGGGUGGACCUUUUUCAACAUUCAA Northern blotting (2.4 kb transcript); upstream and downstream genes are on the opposite strand 9696785 (Fujita et al., J. Bacteriol. 1998, 180(16):4309-4313); BSORF The putative terminator UGCUCCCCUAAAAGUAGAUAGAUGAAUUUUAGAAAAUCUGUUUGCCUUGGGGAGUUUUUUCAUGGCUGG (dG = -19.5 kcal/mole), located close to the stop codon, does not agree well with the Northern blotting result.
yycS yycS 4134775..4134823 -17.4 AUAAAGCCGGCGUUCUGAGAACGUCCGGCUUUUUCUUUUACUUC Northern blotting; upstream and downstream genes are on the opposite strand BSORF
yycR yycR 4134785..4134833 -17.4 AAAAAGCCGGACGUUCUCAGAACGCCGGCUUUAUUGCUGGUAAU Northern blotting BSORF
yycO,yycP,yycQ yycOPQ 4136347..4136391 -9.1 AUGAAGAGACUGGUGUGAAGUCUCUUUUUUUGUUGAACC Northern blotting BSORF The Northern blotting result in BSORF suggests an mRNA transcript of about 2.2 kb, which would correspond to a yycOPQ transcript. The transcription map drawn in BSORF, however, shows a yycOP transcript; no Northern blotting experiment was done with a yycQ probe.
yycN yycN 4138673..4138716 -10.1 AAAAGGGCCUGAUAAAGGCCUUUUUCUGUAAACGA Northern blotting BSORF
rapG,phrG rapG-phrG 4140523..4140584 -12.9 AAGAAUCCUAAAACGGUUUGUAGUUUUAGGAUUCUUUCAUCUUUUC Northern blotting 11466295 (McQuade et al., J. Bacteriol. 2001, 183(16):4905-4909); BSORF Internal promoter in front of phrG. Northern blotting results in BSORF show a rapG-phrG transcript and a shorter phrG transcript.
rocD,rocE,rocF rocDEF 4140697..4140733 -10.3 AAACCCCCGCACCCGCGGGUUUUCAGCGUGUCGA translational fusion with lacZ; Northern blotting 7540694 (Gardan et al., J. Mol. Biol. 1995, 249(5):843-856); BSORF
rocR rocR 4146501..4146548 -13.6 UUCAACUGAACGGGCGUGACCCCUGUUCAGUUUUUUUUGCAUAUC Northern blotting; upstream and downstream genes are on the opposite strand BSORF; SubtiList
yycF,yycG,yycH,yycI,yycJ,yyxA yycFGHIJ-yyxA 4146552..4146602 -17.6 AAAAGCAGUCUGGCAUCGUUGCCAGGCUGUUUUGAUAUGCAAAA Northern blotting (7.4 kb transcript); transcriptional fusions 9829949 (Fabret & Hoch, J. Bacteriol. 1998, 180(23):6375-6383); 10878122 (Fukuchi et al., Microbiology 2000, 146(Pt.7):1573-1583); BSORF Internal promoter in front of yyxA, leading to a 1.4 kb transcript. A shorter (2.4 kb) yycFG transcript was also detected.
purA purA 4154411..4154451 -17.8 GUCUGCAAGCCCCUAUUUAAGGGGCUUGUUUUUUGUUUGAAAG Northern blotting (1.40 kb transcript) 1312531 (Mantsala & Zalkin, J. Bacteriol. 1992, 174(6):1883-1890); 15241682 (Nickel et al., Mol. Genet. Genomics 2004, 272(1):98-107)
dnaC dnaC 4156462..4156502 -15.9 AUAAGCCCCAAGAGCUGCUCUUGGGGUUUUUUUCAUUCGAA Northern blotting BSORF
yycD yycD 4158223..4158263 -12.1 GAAAGCCUUCGCUGCAGCGAGGGUUUUUUAGCGGUUAU upstream and downstream gene are on the opposite strand SubtiList
yycC,yycB yycCB 4160017..4160052 -12.9 AUAAAGCGGGGAAGAUAUCUCCGCUUUUUUCUUUGAAUA Northern blotting (1.4 kb transcript) 12823818 (Yoshida et al., Mol. Microbiol. 2003, 49(1):157-165); SubtiList Northern blotting results in BSORF show a yycB-yycA transcript and a monocistronic yycB transcript
yybS,yybT,rplI yybST-rplI 4162181..4162230 -19.4 GAAAAGAGGCUUGGAUUCAUCCAAGCCUCUUUUUUUAUUCCACG Northern blotting BSORF Northern blotting results in BSORF suggest the presence of an internal promoter in front of rplI
cotF cotF 4166605..4166649 -21.7 AAACAAGCAGCAAAGGAGUUCCCUUUGCUGCUAUUUCUGCUGAUCCUU Northern blotting; upstream and downstream genes are transcribed in the opposite direction BSORF
yybR yybR 4166611..4166663 -19.1 AAAUAGCAGCAAAGGGAACUCCUUUGCUGCUUGUUUUAUUUCAUU Northern blotting; upstream and downstream gene are on the opposite strand BSORF; SubtiList
ppaC ppaC 4168144..4168194 -14.8 AAAAAGCAUCCCGCGUCGGGAUGCUUUUUCUUAUUCACC Northern blotting; upstream and downstream gene are on the opposite strand BSORF; SubtiList
yybP yybP 4168152..4168208 -14.8 AAAAAGCAUCCCGACGCGGGAUGCUUUUUGCUUAUUCAG Northern blotting; upstream and downstream gene are on the opposite strand BSORF
yybN,yybM,yybL,yybK,yybJ yybNMLKJ ND ND ND Northern blotting BSORF Northern blotting results in BSORF suggest the existence of readthrough terminators after yybN and yybM. SubtiList shows a terminator GAAAAAATTTAGAATGATAATCTTTTTATAAGATTATCATTTTTATTTATTCTATTA at position 4172616..4172672 downstream of yybN.
yybH,yybI yybHI 4175858..4175912 -12.4 AAAAAGAGUGCUUUUCAGCAAGCACUCUUUAUUCCAGUUUAA Northern blotting BSORF
yybG yybG 4178143..4178184 -8.3 AAAAAGGACCCGCUAACGGUCCUUUUUUACUGAUCAA Northern blotting; upstream and downstream gene are on the opposite strand BSORF
yybF yybF 4178150..4178192 -8.8 AAAAAGGACCGUUAGCGGGUCCUUUUUUAUUUCCAAU Northern blotting; upstream and downstream gene are on the opposite strand BSORF; SubtiList
yybE,yybD,yybC yybEDC 4181478..4181523 -10.3 UCUGCGGCAGGCAGCUGCCAUUUUUUCUUUUUGGG Northern blotting BSORF; SubtiList
yyaT,yyaS yyaTS 4184104..4184152 ND ND Northern blotting BSORF
tetL,tetB tetLB 4186237..4186289 -17.9 UGAAAGGAUCAAUCUUGUGAAAGUAAUUCAAGGUUGAUCCUUUUUUGUAAAAUGA Northern blotting BSORF Northern blotting results in BSORF suggest the existence of an internal promoter in front of tetB
yyaO yyaO 4188705..4188769 -13.8 UAAAACCUGUAAUCCGUAACCACGCGGUAGCAGGUUUUUUUAUUUGCUU Northern blotting BSORF; SubtiList
yyaL yyaL 4192258..4192320 -22.0 AUUAAUAAGCAGCAGGGAUUAAGACCCUUGCUGCUUACUUUUUGAUUUCUUAU Northern blotting; downstream gene is on the opposite strand BSORF
yyaK yyaK 4192268..4192327 -8.9 GAACACGGAAAACAUUGUUUCCGCUUUUUCGAUCAGUGA Northern blotting; upstream and downstream gene are on the opposite strand BSORF
exoA,ccpB exoA-ccpB 4195788..4195816 ND ND Northern blotting BSORF; 9457849 (Chauvaux et al., J. Bacteriol. 1998, 180(3):491-497); 10540738 (Shida et al., Biosci. Biotechnol. Biochem. 1999, 63(9):1528-1534) Chauvaux et al. note that a ccpB-lacZ translational fusion was not expressed when only 183 nucleotides of upstream DNA were present, suggesting that ccpB is transcribed from a promoter further upstream. Chauvaux et al. propose an exoA-ccpB-yyaHI operon. Between exoA and ccpB, the potential terminator UAUAUGAUGAGAUAGCAGUAAGGAUUUUACACUUACUGCUUUUUUUAUAUGAAA (dG = -12.5 kcal/mole) was found (SubtiList). Microarray data show a small probability (0.06 Bayesian probability) that exoA and ccpB are in the same operon. The Northern blotting results show a transcript of about 2.0 kb (BSORF), whereas exoA consists of 756 basepairs. However, the corresponding paper by Shida does not mention the inferred operon structure of exoA. The Northern blotting was performed with an exoA probe only.
yyaF,rpsF,ssb,rpsR yyaF-rpsF-ssb-rpsR 4197579..4197633 -21.4 GUAAAGAGCAAGGACCUUCGGGUUCUUGCUCUUUUUUAUAGGGGGG Northern blotting (2.4 kb transcript) 14762004 (Lindner et al., J. Bacteriol. 2004, 186(4):1097-1105) Internal promoter in front of rpsF, leading to a 1.2 kb transcript. Northern blotting results in BSORF also show a yyaDEF-rpsF-ssb-rpsR transcript.
yyaC yyaC 4204525..4204581 -9.3 AAAAACCAUCUUCGUUUGAAAGAUGGUUUUUUCAUUUAUGA Northern blotting; upstream and downstream genes are on the opposite strand BSORF
soj,spo0J soj-spo0J 4204541..4204584 -10.9 AAAAACCAUCUUUCAAACGAAGAUGGUUUUUAUUUUAUAUG Northern blotting BSORF; SubtiList
yyaB yyaB 4206886..4206930 -17.1 AAAAAGCUCUCCUGCUUUUCAGGAGAGCUUCUAUUUUGGUAUG Northern blotting; upstream and downstream genes are on the opposite strand BSORF
thdF,gidA,gidB,yyaA thdF-gidAB-yyaA 4206884..4206925 -18.6 UAGAAGCUCUCCUGAAAAGCAGGAGAGCUUUUUAUAUUUUUAA Northern blotting 11807071 (Sievers et al., J. Bacteriol. 2002, 184(4):1102-1111); BSORF; SubtiList Internal promoter and possibly a readthrough terminator are located upstream of yyaA.
spoIIIJ,jag spoIIIJ-jag 4212178..4212241 -17.6 UAAAACCGAAGUCCGAUAAAAAUUGGAUUUCGGUUUUUUUGUAUCCGA Northern blotting 1487728 (Errington et al., J. Gen. Microbiol. 1992, 138(Pt.12):2609-2618); BSORF; SubtiList Northern blotting results in BSORF also indicate the presence of a rpmH-rnpA-spoIIIJ-jag transcript; Errington et al. also suggest that such longer transcripts may exist.
rpmH rpmH 4214250..4214292 -16.1 GCUUAGGCCACUGAAUAAUGUCAGUGGUCUUUUUUCACGUUAUG proposed 2987847 (Moriya et al., Nucleic Acids Res. 1985, 13(7):2251-2265)